Initiation of translation in bacteria by a structured eukaryotic IRES RNA

LETTER

doi:10.1038/nature14219

Initiation of translation in bacteria by a structured

eukaryotic IRES RNA

Timothy M. Colussi

1,2

{*, David A. Costantino

1,2

*, Jianyu Zhu

{, John Paul Donohue

, Andrei A. Korostelev

{, Zane A. Jaafar

Terra-Dawn M. Plank

{, Harry F. Noller

& Jeffrey S. Kieft

1,2

The central dogma of gene expression (DNA to RNA to protein) is

universal, but in different domains of life there are fundamental mech-

anistic differences within this pathway. For example, the canonical

molecular signals used to initiate protein synthesis in bacteria and

eukaryotes are mutually exclusive

. However, the core structures and

conformational dynamics of ribosomes that are responsible for the

translation steps that take place after initiation are ancient and con-

served across the domains of life

. We wanted to explore whether an

undiscovered RNA-based signal might be able to use these conserved

features, bypassing mechanisms specific to each domain of life, and

initiate protein synthesis in both bacteria and eukaryotes. Although

structured internal ribosomeentry site(IRES)RNAs can manipulate

ribosomes to initiate translation in eukaryotic cells, an analogous

RNA structure-based mechanism has not been observed in bacteria.

Herewe report our discovery that a eukaryotic viral IRES can initiate

translation in live bacteria. We solved the crystal structure of this

IRES bound to a bacterial ribosome to 3.8 A

resolution, revealing

that despite differences between bacterial and eukaryotic ribosomes

thisIRES binds directly to both andoccupiesthespacenormally used

by transfer RNAs. Initiation in bothbacteriaand eukaryotes depends

on the structure of the IRES RNA, but in bacteria this RNA uses a

different mechanism that includes a form of ribosome repositioning

after initial recruitment. This IRES RNA bridges billions of years of

evolutionary divergence and provides an example of an RNA struc-

ture-based translation initiation signal capable of operating in two

domains of life.

Bacteria cannot recognize the ‘cap’ on the 59 end of eukaryotic mes-

senger RNAs and eukaryotic ribosomes cannot use the Shine–Dalgarno

sequence (SDS)

(Extended Data Fig. 1a). Although non-canonical mech-

anisms exist

3,4

, there is no known translation initiation signal that can

operate in multiple domains of life at any location in an mRNA. De-

spite this divergence there is strong conservation in the functional core

of the ribosome, where mRNA and tRNAs interact and move

. In fact,

the tRNAs used in elongation from bacteria and eukaryotes are inter-

changeable

. Therefore, we asked whether a structuredRNA embedded

in an mRNA sequence could interact with conserved ribosome features

in the decoding groove and initiate translation in both bacteria and eu-

karyotes. Candidates for such RNAs are the intergenic region (IGR)

IRESs from Dicistroviridae viruses. In eukaryotes, these IRESs act inde-

pendently of a 59 cap

, adopt a functionally essential compact fold that

docks within the ribosome

7–9

without initiation factors or a start codon

10–16

and partially mimic tRNA (Extended Data Fig. 1b, c)

12,17–19

. It is pro-

posed that they drive translation initiation by co-opting the ribosome’s

conserved elongation cycle

17,19–22

, and they operate in diverse eukaryo-

tic systems

6,23

We generated an inducible expression vector encoding a single mRNA

containing two independent luciferase (LUC) reporters (Extended Data

Fig. 1d)

, and verified that it allowed the simultaneous measurement of

initial rates of production of each protein (Extended Data Figs 2 and 3).

We used this construct to test whether an IGR IRES RNA can drive

translation in live bacteria. Renilla luciferase (RLUC) was placed to ini-

tiate translation from an SDS (and ‘enhancer’ sequence), and firefly lu-

ciferase(FLUC) was placed after a wild-type Plautia stali intestinevirus

(PSIV) IGR IRES. There was some production of both LUCs before in-

duction (due to expected ‘leaky expression’; Extended Data Fig. 4), but

induction resulted in a marked increase in both reporters; the production

*These authors contributed equally to this work.

Department of Biochemistry and Molecular Genetics, University of Colorado Denver School of Medicine, Aurora, Colorado 80045, USA.

Howard Hughes Medical Institute, University of Colorado Denver

School of Medicine, Aurora, Colorado 80045, USA.

Center for Molecular Biology of RNA and Department of Molecular, Cell and Developmental Biology, Sinsheimer Labs, University of California at Santa

Cruz, Santa Cruz, California 95064, USA. {Present addresses: Department of Chemistry and Chemical Biology, Northeastern University, Boston, Massachusetts 02115, USA (T.M.C.); Cocrystal Discovery,

Inc., Mountain View, California 94043, USA (J.Z.); RNA Therapeutics Institute, Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester,

Massachusetts 01655, USA (A.A.K.); Department of Reproductive Medicine, University of California at San Diego, La Jolla California 92093, USA (T.-D.M.P.).

Wild type

FLUC

RLUC

FLUC

RLU (× 10

)

SDS+en

Upstream SDS_K/O

Time (min)

–100 0 100 200

RLUC

RLU (× 10

)

RLU min

–1

(× 10

)

1.0

2.0

3.0

0.5

1.5

2.5

Wild type

Upstream

SDS_K/O

Internal SDS

CSFV

RLUC

Wild type

Upstream

SDS_K/O

Internal SDS

CSFV

FLUC

100

120

140

4,000

5,000

Wild type

Upstream

SDS_K/O

Internal SDS

CSFV

FLUC/

RLUC

Wild-type PSIV IRES ratio (%)

Time (min)

–100 0 100 200

Time (min)

–100 0 100 200

Time (min)

–100 0 100 200

RLU (× 10

)

RLU (× 10

)

RLU min

–1

(× 10

)

Figure 1

Translation initiation assays in bacteria. a, Full-length wild-type

IRES. Left, diagram of the construct. en, enhancer. Middle, graph shows relative

light units (RLU) from the upstream RLUC as a function of time. Dashed

grey line is t 5 0, the point of induction. The trace is the average signal of at least

three experiments, with error bars showing 1 standard deviation (s.d.) from the

mean. Right, graph shows FLUC expression from the IRES. b, Diagram

and traces from the Upstream SDS_K/O mutant. Note the change in scale of the

y-axis for FLUC. c, Initial rates of RLUC and FLUC production, and the FLUC/

RLUC ratio for the indicated constructs. Error bars represent 1 s.d. from

the mean from three biological replicates. See Extended Data Figs 2 and 5 for

diagrams and raw traces of the Internal SDS and CSFV constructs.

110 | NATURE | VOL 519 | 5 MARCH 2015

of FLUC is consistent with translation beginning at the IRES (Fig. 1c

and Extended Data Fig. 2). Removing the RLUC-driving SDS (Upstream

SDS_K/O; all mutants shown in Extended Data Fig. 5) diminished

production of RLUC, but FLUC production increased more than tenfold

(Fig. 1b; all raw LUC data in Extended Data Table 1a), which we attrib-

uted to decreased competition for ribosomes and to ribosomes initiat-

ing independently at the IRES. Replacing the IGR IRES with the IRES

fromclassicalswine fever virus (CSFV) resultedinnegligibleFLUC pro-

duction (Extended Data Fig. 2), demonstrating specificity for the IGR

IRES.

A source of initiation from the IGR IRES could be a ‘cryptic’ SDS in

the purine-rich sequence between the IRES and the FLUC start codon

(Extended Data Fig. 6). FLUC production from this SDS-like sequence

alone was at ,30% of the wild-type IRES, not enough to account for all

FLUC produced from the IRES. Mutating this SDS-like sequence in the

contextofthe full IRES decreased FLUC production, but translation was

still higher than from an SDS or the SDS-like sequence. Thus, the struc-

tured IRES can drive FLUC production without the SDS-like sequence,

but both probably contribute to function when present.

To determine the structural basis for IGR IRES activity in bacteria,

we solved the crystal structure of the full-length IRES RNA

N 70S ribo-

some complex to 3.8 A

resolution. In eukaryotes, IGR IRES domains

1and2(domain112) contact both subunits, whereas domain 3 mimics

an mRNA–tRNA interaction on the small subunit (Extended Data

Fig. 1b)

7,8,10,11,19,25

. We observed electron density for domain 3 in the

P site as in the crystal structure of isolated domain 3 bound to 70S

ribosomes

(Fig. 2a and Extended Data Fig. 7); this may represent an

initiation-state or translocated IRES. The density of domain 112 was

weak but its location could be modelled using the crystal structure of

unbound PSIV IGR IRES domain 112 (Fig. 2a)

. The location of do-

main 112 in the 70S ribosome differs from IGR IRES

N 80S ribosome

complexes, with domain 3 in the A site

22,27

. In 80S ribosomes, domain

112 interacts with the eukaryotic-specific ribosomal protein eS25 and

the L1 stalk

10,11,28,29

, which is structurally distinct from that in bacterial

ribosomes

. In the full-length IRESN 70S structure, the L1 stalk is dis-

placed ,15 A

compared with the structure containing domain 3 only

(Fig. 2b). The absence of eS25 and differences in the L1 stalk may be

responsible for the partial disorder and location of the IRES. Nonethe-

less, the structure clearly illustrates that the compactly folded IRES can

bind in the tRNA-binding sites of bacterial ribosomes.

The compact structure of the IGR IRES is essential for its function in

eukaryotes

25,26

, and the IRESN 70S structure suggested that this is also

true in bacteria. To test this, we disruptedtwo pseudoknots essentialfor

the compact structure of the IRES, both individually (PK1_K/O, PK2_

K/O) and together (PK11PK2_K/O), and measured activity (Fig. 3a, b

and Extended Data Fig. 8a)

. FLUC production decreased in all three

mutants, with FLUC production in the double mutant at a level that

could be accounted for by activity from the cryptic SDS-like sequence.

Indeed, disruption of both pseudoknots and the SDS-like sequence

(Downstream SDS-like_K/O1PK11PK2_K/O) abrogated IRES activ-

ity (Extended Data Fig. 6). Isolated IRES domain 3 operated similarly

to the domain-112-disrupting mutant (PK2_K/O). Thus, IGR IRES

translation in bacteria depends on a compact RNA structure and although

domain 112 is poorly ordered in the crystal, it may be required to form

transient interactions with the ribosome.

We explored the putatively transient IGR IRES

N 70S interactions using

translationally competent cell-freeextracts. In rabbit reticulocyte lysate

(RRL; positive control) the IRES forms 80S ribosomes both in the pres-

ence and absence of a non-hydrolysable GTP analogue (GMPPNP)

L1 stalk

30S

50S

L1 stalk

30S

50S

IRES

domain 3

IRES

domain 1+2

Figure 2

IRESN 70S ribosome structure. a, Crystal structure of a full-length

PSIV IGR IRES bound to Thermus thermophilus 70S ribosomes. Cyan, small

subunit; yellow, large subunit; red, PSIV IRES domain 3; grey, density

corresponding to domain 3; magenta, unbiased difference F

2 F

density

corresponding to domain 112, with the crystal structure of PSIV IGR IRES

domain 112 (black) docked as a rigid body

. b, Superimposition of crystal

structures of the PSIV IGR IRES

N 70S ribosome complex (this work) and the 70S

ribosome. Yellow, IRES-bound 50S subunit. Domain 112 shifts the L1 stalk

relative to its position in tRNA-bound complexes by ,15 A

0.1

0.2

0.3

0.4

0.5

0.6

0 5 10 15 20 25

PSIV IRES RNA

PSIV IRES RNA + E. coli lysate

+ GMPPNP

Fraction total CPM

Fraction

0.1

0.2

0.3

0.4

0.5

510152025

Fraction total CPM

Fraction

PSIV IRES RNA

PSIV IRES RNA + RRL

+ GMPPNP

80S

40S

0.02

0.04

0.06

0.08

0.10

0.12

510152025

Fraction total CPM

Fraction

PSIV IRES RNA + E. coli lysate

PSIV IRES RNA + E. coli lysat

+ GMPPNP

PSIV IRES RNA + E. coli lysat

+ hygromycin B

5′

3′

70S

30S

Wild-type PSIV IRES ratio (%)

100

120

Wild type

PK1_K/O

PK2_K/O

Domain 3

PK1+PK2_K/O

FLUC/RLUC

Wild type

PK1_K/O

PK2_K/O

Domain 3

PK1+PK2_K/O

FLUC

1.0

2.0

0.5

1.5

2.5

3.0

3.5

Wild type

PK1_K/O

PK2_K/O

Domain 3

PK1+PK2_K/O

RLUC

SDS+en

PK2_K/O

PK1_K/O

SDS+en

PK1+PK2_K/O

SDS+en

Domain 3

RLU min

–1

(× 10

)

RLU min

–1

(× 10

)

5′

3′

5′

3′

Figure 3

Importance of IRES structure and

ribosome binding. a, IRES constructs with

structural domains disrupted or removed. en,

enhancer. b, Rates of LUC production and LUC

ratio. Error bars represent 1 s.d. from the mean

from three biological replicates. c, Ribosome

assembly assay with the PSIV IGR IRES in RRL,

resolved on a sucrose gradient. Locations of

complexes are indicated. CPM, counts per minute.

d, As for c, but in E. coli lysate. f,Asford, but

with an IRES RNA containing a downstream

sequence to include the FLUC start codon. c–e,The

addition of GMPPNP or hygromycin B is

indicated. Data from one experiment are shown.

LETTER RESEARCH

5 MARCH 2015 | VOL 519 | NATURE | 111

(Fig.3c).Incontrast,70SformationontheIRESinEscherichia coli lysate

was virtually undetectable (Fig. 3d). We repeated the experiment with

an IRES RNA containing the FLUC AUG and several codons down-

stream of the IRES to allow initiation to occur and stabilize the resultant

complexes. Both IRES

N70S complexes and IRESN 30S complexes formed

in the presence of the elongation inhibitor hygromycin B (Fig. 3e). In

the E. coli lysate, the amount of IRES–ribosome complex is low compared

to that observed for the RRL, consistent with formation of an unstable

or transient complex.

In eukaryotes, IGR IRES-driven translation begins directly on the

IRES and is proposed to co-opt the ribosome’s elongation cycle

17,19,21,22

;

we asked whether this is true in bacteria, in which the IRES–ribosome

interactions appear different and transient. Removal of the FLUC start

codon located 15 nucleotides downstream of the IRES structure (DAUG)

resulted in a complete loss of FLUC production, while a stop codon

placed upstream of the FLUC start codon (uSTOP) had little effect

(Fig. 4a, b and Extended Data Fig. 8b). Removal of 1 or 2 nucleotides

just upstream of the FLUC AUG (F-SHIFT(21) and F-SHIFT(22))

had little effect. These results are consistent with translation in bacteria

beginning on the FLUC AUG, not directly at the IRES on a non-AUG

codon. This implies a repositioning of the ribosome from the IRES to

the FLUC start codon. To explore this, we created a construct with an

out-of-frame start codon between the IRES and the start codon (uAUG);

this mutation decreased activity but not to the degree that would be ex-

pected if this codon were being used efficiently. The source of this dis-

crimination is not clear, but we posit that selection of the FLUC AUG

is assisted by the nearly ideally positioned cryptic SDS-like sequence

upstream. Constructs withalterations betweenthe IRES andFLUCstart

codon all had decreased activity in the context of the PK11PK2_K/O

mutation (Extended Data Fig. 9), indicating that IRES structural integ-

rity remains necessary for their function.

The mechanism of theIRESstudied hereinbacteria is moreprimitive

than in eukaryotes. We propose that the structured IRES RNA forms

interactionswithbacterial ribosomes that are transient and weakerthan

the highly tuned interactions that occur in eukaryotes, but allow inter-

nal entry of the ribosome to the message. Recruited subunits or ribo-

somes are repositioned to a downstream start codon where protein

synthesis starts. That a compact IRES RNA can use this primitive mech-

anism suggests that RNA structure-driven or structure-assisted initia-

tion may be used in potentially all domains of life, driven by diverse

RNAs perhaps possessing tRNA-like character or decoding groove bind-

ing capability.

Online Content Methods, along with any additional Extended Data display items

and Source Data, are availablein the online version ofthe paper; references unique

to these sections appear only in the online paper.

Received 29 January 2014; accepted 7 January 2015.

Published online 4 February 2015.

1. Hershey, J. W., Sonenberg, N. & Mathews, M. B. Principles of translational control:

an overview. Cold Spring Harb. Perspect. Biol. 4, a011528 (2012).

2. Melnikov, S. et al. One core, two shells: bacterial and eukaryotic ribosomes. Nature

Struct. Mol. Biol. 19, 560–567 (2012).

3. Malys, N. & McCarthy, J. E. Translation initiation: variations in the mechanism can

be anticipated. Cell. Mol. Life Sci. 68, 991–1003 (2011).

4. Moll,I., Grill, S., Gualerzi,C. O. & Blasi, U.Leaderless mRNAs in bacteria: surprises in

ribosomal recruitment and translational control. Mol. Micr. obiol. 43, 239–246

(2002).

5. Berthelot, F., Bogdanovsky, D., Schapira, G. & Gros, F. Interchangeability of factors

and tRNA’s in bacterial and eukaryotic translation initiation systems. Mol. Cell.

Biochem. 1, 63–72 (1973).

6. Hertz, M. I. & Thompson, S. R. Mechanism of translation initiation by Dicistroviridae

IGR IRESs. Virology 411, 355–361 (2011).

7. Schu

ler, M. et al. Structure ofthe ribosome-bound cricket paralysis virus IRES RNA.

Nature Struct. Mol. Biol. 13, 1092–1096 (2006).

8. Spahn, C. M. et al. Cryo-EM visualization of a viral internal ribosome entry site

bound to human ribosomes: the IRES functions as an RNA-based translation

factor. Cell 118, 465–475 (2004).

9. Pestova, T. V., Lomakin, I. B. & Hellen, C. U. Position of the CrPV IRES on the 40S

subunit and factor dependence of IRES/80S ribosome assembly. EMBO Rep. 5,

906–913 (2004).

10. Jan, E. & Sarnow, P. Factorless ribosome assembly on the internal ribosome entry

site of cricket paralysis virus. J. Mol. Biol. 324, 889–902 (2002).

11. Nishiyama, T. et al. Structural elements in the internal ribosome entry site of Plautia

stali intestine virus responsible for binding with ribosomes. Nucleic Acids Res. 31,

2434–2442 (2003).

12. Jan, E. et al. Initiator Met-tRNA-independent translation mediated by an internal

ribosome entry site element in cricket paralysis virus-like insect viruses. Cold

Spring Harb. Symp. Quant. Biol. 66, 285–292 (2001).

13. Thompson, S. R., Gulyas, K. D. & Sarnow, P. Internal initiation in Saccharomyces

cerevisiae mediated by an initiator tRNA/eIF2-independent internal ribosome

entry site element. Proc. Natl Acad. Sci. USA 98, 12972–12977 (2001).

14. Wilson, J. E., Pestova, T. V., Hellen, C. U. & Sarnow, P. Initiation of protein synthesis

from the A site of the ribosome. Cell 102, 511–520 (2000).

15. Sasaki, J. & Nakashima, N. Methionine-independent initiation of translation in the

capsid protein of an insect RNA virus. Proc. Natl Acad. Sci. USA 97, 1512–1515

(2000).

16. Sasaki, J. & Nakashima, N. Translation initiation at the CUU codon is mediated by

the internal ribosome entry site of an insect picorna-like virus in vitro. J. Virol. 73,

1219–1226 (1999).

17. Costantino, D. A., Pfingsten, J. S., Rambo, R. P. & Kieft, J. S. tRNA–mRNA mimicry

drives translation initiation from a viral IRES. Nature Struct. Mol. Biol. 15, 57–64

(2008).

18. Jan, E., Kinzy, T. G. & Sarnow, P. Divergent tRNA-like element supports initiation,

elongation, and termination of protein biosynthesis. Proc. Natl Acad. Sci. USA 100,

15410–15415 (2003).

19. Zhu, J. et al. Crystal structures of complexes containing domains from two viral

internal ribosome entry site (IRES) RNAs bound to the 70S ribosome. Proc. Natl

Acad. Sci. USA 108, 1839–1844 (2011).

20. Hellen, C. U. IRES-induced conformational changes in the ribosome and the

mechanism of translation initiation by internal ribosomal entry. Biochim. Biophys.

Acta 1789, 558–570 (2009).

21. Yamamoto, H., Nakashima, N., Ikeda, Y. & Uchiumi, T. Binding mode of the first

aminoacyl-tRNA in translation initiation mediated by Plautia stali intestine virus

internal ribosome entry site. J. Biol. Chem. 282, 7770–7776 (2007).

22. Ferna

ndez, I. S., Bai, X. C., Murshudov, G., Scheres, S. H. & Ramakrishnan, V.

Initiation of translation by cricket paralysis virus IRES requires its translocation in

the ribosome. Cell 157, 823–831 (2014).

23. Deniz,N.,Lenarcic,E.M.,Landry,D.M.&Thompson,S.R.Translationinitiationfactors

are not required for Dicistroviridae IRES function in vivo. RNA 15, 932–946 (2009).

24. Stoneley, M., Paulin, F. E., Le Quesne, J. P., Chappell, S. A. & Willis, A. E. c-Myc 59

untranslated region contains an internal ribosome entry segment. Oncogene 16,

423–428 (1998).

25. Costantino, D. & Kieft, J. S. A preformed compact ribosome-binding domain in the

cricket paralysis-like virus IRES RNAs. RNA 11, 332–343 (2005).

26. Pfingsten, J. S., Costantino, D. A. & Kieft, J. S. Structural basis for ribosome recruit-

ment and manipulation by a viral IRES RNA. Science 314, 1450–1454 (2006).

27. Koh, C. S., Brilot, A. F., Grigorieff, N. & Korostelev, A. A. Taura syndrome virus IRES

initiates translation by binding its tRNA-mRNA-like structural element in the

ribosomal decoding center. Proc. Natl Acad. Sci. USA 111, 9139–9144 (2014).

28. Nishiyama, T., Yamamoto, H., Uchiumi, T. & Nakashima, N. Eukaryotic ribosomal

protein RPS25 interacts with the conserved loop region in a dicistroviral intergenic

internal ribosome entry site. Nucleic Acids Res. 35, 1514–1521 (2007).

29. Landry, D. M., Hertz, M. I. & Thompson, S. R. RPS25 is essential for translation

initiation by the Dicistroviridae and hepatitis C viral IRESs. Genes Dev. 23,

2753–2764 (2009).

30. Ben-Shem, A. et al. The structure of the eukaryotic ribosome at 3.0 A

resolution.

Science 334, 1524–1529 (2011).

1.0

2.0

0.5

1.5

Wild type

ΔAUG

uSTOP

uAUG

F-SHIFT(–1)

F-SHIFT(–2)

Wild type

ΔAUG

uSTOP

F-SHIFT(–1)

F-SHIFT(–2)

uAUG

Wild-type PSIV IRES ratio (%)

100

120

Wild type

ΔAUG

uSTOP

F-SHIFT(–1)

F-SHIFT(–2)

uAUG

Wild type

SDS+en PSIV IRES SDS+en PSIV IRES

SDS+en PSIV IRES

SDS+en

PSIV IRES

ΔAUG

uSTOP

uAUG

F-SHIFT(–1)

F-SHIFT(–2)

RLU min

–1

(× 10

)

RLU min

–1

(× 10

)

FLUC/RLUC

FLUC

RLUC

Figure 4

Location of initiation on an IGR IRES in bacteria. a, Constructs

designed to determine the location of initiation. For uAUG and uSTOP, the

start and stop codons are underlined. en, enhancer. b, Rates of LUC production

and LUC ratio from these constructs. Error bars represent 1 s.d. from the

mean from three biological replicates.

RESEARCH LETTER

112 | NATURE | VOL 519 | 5 MARCH 2015

Acknowledgements We thank the members of the Kieft laboratory for insight and

discussion and the staff at the Advanced Photon Source for their support. The original

PSIV IGR IRES-containing plasmid was from N. Nakashima and the source of the

luciferase genes was a plasmid from A. Willis. This work was supported by grants

GM-17129 and GM-59140 from the National Institutes of Health (NIH) and

MCB-723300 from the National Science Foundation (to H.F.N.), grant GM-103105

from the NIH (to A.A.K.), and grants GM-97333 and GM-81346 from the NIH (to J.S.K.).

J.S.K. is an Early Career Scientist of the Howard Hughes Medical Institute. T.-D.M.P. was

an American Heart Association Predoctoral Scholar (10PRE260143).

Author Contributions T.M.C. and J.S.K. designed the experiments and the constructs

tested. T.M.C. and D.A.C. conducted the bacterial functional assays. Clones were

generated by T.M.C., T.-D.M.P. and Z.A.J. J.S.K. performed the ribosome association

assays. Ribosomes were purified, crystals grown, and the structure solved by J.P.D., J.Z.

and A.A.K. under the supervision of H.F.N. J.S.K. provided overall supervision and

guidance, and together with T.M.C. and D.A.C. wrote the manuscript with input from all

authors.

Author Information Atomic coordinates and structure factor amplitudes have been

deposited in the Protein Data Bank under accession number 4XEJ. Reprints and

permissions information is available at www.nature.com/reprints. The authors declare

no competing financial interests. Readers are welcome to comment on the online

version of the paper. Correspondence and requests for materials should be addressed

to J.S.K. (jeffrey.kieft@ucdenver.edu).

LETTER RESEARCH

5 MARCH 2015 | VOL 519 | NATURE | 113

METHODS

Plasmid construction. DNA containing the Plautia stali intestine virus (PSIV)

IGR IRES(nucleotides6000–6195) betweenthe RLUC and FLUCcoding sequences

was ligated into the KpnI and SacI sites of a pET30a vector (Novagen) using T4

DNA Ligase (New England Biolabs). The resultant construct contained 15 nucleo-

tides of sequence between the 39 end of the IRES (designated as the 39 end of pseu-

doknot 1, nucleotide 6195) and the AUG start codon of the FLUC open reading

frame (ORF).

Generation of mutants. Mutants were generated using several methods. First,

PCR with appropriate forward and reverse primers (IDT) was used to generate two

halves of the desired sequence. The halves were annealed and amplified by PCR

using the T7 and T7 terminator sequencing primers. The resultant DNA was then

ligated into the same pET30a vector using the above restriction sites.

Second, site-directed mutagenesis using the QuikChange (Agilent) mutagenesis

strategy using appropriate primer pairs.

Third, insertion of PCR-amplified DNA or synthesized gBlock gene fragments

(IDT) intothedual-LUC-containing pET30a vectorbetween the SpeI and NcoI sites

(between the Renilla and firefly genes) using a ligation-independent cloning (LIC)

method, In-Fusion HD Cloning Plus (Clontech Laboratories). PCR products or

gBlocks contained sequence overlapping 12 base pairs (bp) 59 of the SpeI site and

12 bp 39 of the NcoI site of the vector. Assembled constructs maintained both re-

striction sites.

Fourth, for the T7 knockout construct, a pET30a vector containing a mutated

T7 promoter (TAAATGGTGTCTGAATTC) was synthesized(DNA 2.0)andDNA

coding for the wild-type PSIV flanked by the two LUC genes was amplified by PCR.

The PCR product was inserted between the KpnI and SacI sites in the mutated

T7 vector by LIC.

Fifth, the mutant in which the PSIV IGR IRES was replaced by a SDS (without

enhancer sequence) was generated by ligating the DNA fragment into the pET30a/

dual-LUC vector using the SpeI and NcoI sites.

Bacterial cell culture. Rosetta DE3 cells (Novagen) were transformed with the plas-

mids described earlier and grown overnight in 5 ml Luria broth (LB) with kana-

mycin (Fisher) at 37 uC with constantagitation to generatea starter culture.To start

the experiment, 50 ml of LB containing kanamycin was inoculated with 1 ml of the

overnight starter culture. The 50 ml cultures were grown with agitation at 37 uC

to an absorbance at 600 nm of 0.6 (measured on a Thermo Scientific NanoDrop

2000c spectrophotometer). The cultures were induced with 1 mM isopropyl-b-

D-

thiogalactoside (IPTG) (Gold Bio) and allowed to grow for 4 h. Samples (50 ml)

were taken at 10–30 min intervals.

Measurement of LUC activity. At eachtime point,50 mlofcellculturewasremoved,

the cells were pelleted by centrifugation, and the supernatant was removed. Cells

were resuspended in 300 ml13 PassiveLysis Buffer(PLB,Promega). Twentymicro-

litres of the resultant cell lysate was added to a 96-well microplate (Greiner Bio-

One). The dual-LUC assay was performed by first adding 100 ml LAR II (Promega)

to measure FLUC activity, then 100 ml of Stop & Glo reagent (Promega) was added

to measure RLUC activity. The assay was performed and measurements were taken

using a Promega Glomax Multi1 detection system.

Determination of IRES activity.FLUC and RLUC activity (expressed as RLU)were

graphed as a function of time for each culture using the program KaleidaGraph.

The initial rate of FLUC and RLUC production was determined using the datafrom

the first 30–40 min after induction. LUC production was generally linear over this

time scale after a 5–10 min lag. IRES activity was then calculated as the ratio of the

initial rate of FLUC to RLUC for each culture. Ratios from individual independent

cultures were averaged. Bar graphs represent averages from at least three indepen-

dent cultures; error bars depict one standard deviation from the mean. This method

corrects for variation in growth, induction, and potential protein stability differ-

ences between cultures.

RNA transcription and purification for ribosome assembly assay. DNA tem-

plates for in vitro transcription were generated by PCR using a plasmid containing

the wild-type PSIV IRES as the template and primers designed to amplify just the

DNAof interest underthe control of a T7 RNApolymerase promoter.The resultant

PCR-generated DNA template was used in in vitro transcription reactions. RNA

was purified from raw transcription reactions by high-performance liquid chro-

matography (HPLC). The first RNA used in assembly assays contained nu-

cleotides 6000–6195 of the PSIV IGR IRES, and the second contained this same

sequence, plus the sequence GAAAAAGAATTTACCATGGAAGACGCCAAAA

ACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCG

CTGGAGAGC downstream of the IRES.

Ribosome assembly assay. RNA for use in assembly assays was 59-end radio-

labelled with P-32 using T4 polynucleotide kinase (NEB), purified by gel electro-

phoresis, and diluted to 1,000 CPM ml

. For the assays in RRL, 1 ml radiolabelled

RNA was combined with 30 ml of lysate supplementedwith amino acids. For the re-

actionwith GMPPNP, 5 ml of a 20 mM stock of the analogue was added to achieve a

final concentration of 2 mM, and an equimolar amount of MgCl

was added. For

the reaction with hygromycin B, 2 ml of a 50 mg ml

stock was added to a final

concentration of 2 mg ml

. RNase-free water was added to a total final volume of

50 ml. For the reactions in E. coli lysate, Promega product #L1030 was used. One

microlitre of labelled RNA was added to 15 ml of lysate and 20 ml of S30 premix

supplemented with 5 ml of the amino acid mix and 1 ml of RNasin RNase inhibitor

(Promega). For the reactions with GMPPNP or antibiotic, the same amounts were

added as for the RRL reactions. Reactions were incubated at 30 uC for 5 min, then

250 ml of ice-cold dilution buffer (40 mM Tris-HCl pH 7.5, 50 mM NaCl, 5 mM

MgCl

, 1 mM dithiothreitol(DTT)) was added and the reactions were immediately

loaded on 15–30% sucrose gradients in dilution buffer. Gradients were centrifuged

at 35,000 r.p.m. for 4 h in an SW41 rotor, then fractionated using a BioComp sys-

tem. The amount of radiation in each fraction was measured and used to generate

the plots. According to the manufacturer, this lysate contains substantial RNase

activity; we attempted to mitigate this effect using RNase inhibitors. However, we

were unable to fully eliminate the activity.

Crystallographic data collection and structure determination. 70S ribosomes

were purified and the 70S

N PSIV IRES complex was prepared and crystallized essen-

tially as previously described

. The IRES RNA used contained nucleotides 6000–

6195 of the PSIV viral RNA. X-ray diffraction data were collected at beamline 23

ID-B at the Advanced Photon Source at Argonne National Laboratory, using an

X-ray wavelength of 1.033 A

and an oscillation angle of 0.2u. For determining the

structure of the 70S

N PSIV IRES complex, one data set obtainedfrom a single crystal

was integrated and scaled using XDS

. 0.4 per cent of the reflections were marked

as test-set(R

free

set) reflectionsand used for cross-validation throughout refinement.

Thepreviously determinedX-ray structureof the 70S ribosome boundwithdomain

3 of the PSIV IRES, obtained from the same crystal form, was used as a molecular

replacement model

. Domain 3 of the IRES and L1 stalk were removed from this

starting model. Initial F

2 F

difference maps were calculated after rigid-body and

simulated-annealing refinement was performed using two-fold non-crystallographic

symmetry (NCS) restraints for the ribosome as previously described

. The dif-

ference maps revealed the positions of the L1 stalk and domain 3 of the PSIV IRES,

allowing us to position the models for these parts of the structure. The density cor-

responding to domain 112 of the IRES revealed the approximate positioning for

this domain but was not sufficient to allow unambiguous building of the structural

model. NCS-restrained structure refinement was carried out using PHENIX

,as

described

. Coot

was used for structure visualization and calculation of NCS-

averaged maps. Figures were rendered using PyMOL

. Information on data col-

lection and refinement statistics is summarized in Extended Data Table 1b.

31. Kabsch, W. Automatic processing of rotation diffraction data from crystals of

initially unknown symmetry and cell constants. J. Appl. Crystallogr. 26, 795–800

(1993).

32. Adams, P. D. et al. PHENIX: building new software for automated crystallographic

structure determination. Acta Crystallogr. D 58, 1948–1954 (2002).

33. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta

Crystallogr. D 60, 2126–2132 (2004).

34. DeLano, W. L. The PyMOL Molecular Graphics System (DeLano Scientific, 2002).

35. Karplus, P. A. & Diederichs, K. Linking crystallographic model and data quality.

Science 336, 1030–1033 (2012).

RESEARCH LETTER

Extended Data Figure 1

Canonical translation initiation signals,

characteristics of IGR IRESs, and experimental design. a, Bacterial mRNAs

(left) use a Shine–Dalgarno sequence (SDS; red) upstream of the AUG start

codon and open reading frame (green) to recruit the 30S subunit (grey).

The interaction is through the anti-SDS (A-SDS, yellow). Three initiation

factors (magenta) are also important. Eukaryotic mRNAs (right) have a 59

7-methyl-guanosine ‘cap’ (red; 7 mG) that is bound by initiation factor 4E (4E,

yellow). Multiple initiation factors (blue and magenta) serve to recruit the 40S

subunit (grey) and allow it to scan to the start codon. b, Left, cryo-electron

microscopy (cryo-EM) reconstruction of an IGR IRES RNA (magenta) bound

to a human 40S subunit (yellow)

. The compact structure occupies the tRNA-

binding groove of the subunit. Right, cryo-EM reconstruction of an IGR

IRES RNA (magenta) bound to a human 80S ribosome

. The 40S subunit is

yellow and the 60S subunit is cyan. The IRES RNA occupies the conserved

intersubunit space. c, Cartoon representation of the secondary structure of a

type 1 IGR IRES RNA (the type to which PSIV belongs). This structure is found

between two open reading frames within the viral RNA genome. The two

independently folded domains (domain 112 and domain 3) are indicated with

dashed grey ovals. The locations of two pseudoknot interactions critical for

inducing the correct IRES folded structure, and thus for function (PK 1 and

PK 2), are shown. d, The structured IRES studied here is found in the intergenic

region of the viral genome (red). It was placed into a dual-luciferase (LUC)

reporter construct (blue, RLUC; yellow, FLUC) and this was cloned into

bacterial expression vector pET30a. This vector was used to transform

Escherichia coli. Induction of the culture leads to expression of the dual-LUC

mRNA. Aliquots of the culture were harvested at defined time points and

the amount of each LUC was measured. These data were used to determine the

initial rate of LUC production (generally linear over the first 30–40 min

post-induction) for each of the two reporters. RLUC served as a consistent

internal control for different bacterial cultures, clones, growth rates, and so on.

LETTER RESEARCH

Extended Data Figure 2

Verification of independent quantifiable LUC

production in bacteria. a, An empty pET30a vector (no inserted LUC reporter

coding sequences) shows negligible signal. b, Traces of LUC activity as a

function of time are shown from a construct in which the RLUC reporter was

driven by the SDS and enhancer sequence from pET30a and FLUC was driven

by an SDS only (Downstream SDS). The red octagon denotes stop codons.

Both LUCs are generated, and RLUC production is higher, as expected.

c, Removal of the SDS driving FLUC production (Downstream SDS_K/O)

results in a loss of FLUC production, as expected. d, Insertion of the IRES from

classical swine fever virus (CSFV) in a position to drive initiation of FLUC

results in negligible FLUC activity. a–d, The y-axis indicates relative light units

(RLU). Error bars represent 1 s.d. from the mean from three biological

replicates. Here and throughout this study, we observed different LUC versus

time profiles with different constructs. For example, the RLUC traces for

the Downstream SDS and Downstream SDS_K/O constructs are different,

despite no change to the SDS driving RLUC production (one shows a decrease

of RLUC in later time points, the other maintains RLUC levels). The reason

for this effect is unknown, but it only appears ,60 min after induction.

e, Despite differences in longer time courses, LUC production was consistent

and linear over the first 30–40 min post-induction. The RLUC and FLUC

traces from the Downstream SDS and Downstream SDS_K/O constructs are

shown. The consistency of these initial rates, before high levels of mRNA

and reporter might build up and affect bacterial behaviour, justified their use as

a means to quantitate LUC production (Extended Data Fig. 3).

RESEARCH LETTER

Extended Data Figure 3

Determination of IRES activity from initial rates

of LUC production. a, Representative graphs of RLUC and FLUC levels at

early time points from three cultures of bacteria transformed with an IRES-

containing bicistronic vector, induced with isopropyl-b-

D-thiogalactoside

(IPTG) at time 5 0. Data from the three cultures are shown as black, green, and

blue points, and a linear fit is shown with a dashed line for each. The slopes of

these fit lines were used as the initial rate of LUC production per minute.

b, Representative table of data for one IRES construct. Data from six cultures

are shown, with initial rates for RLUC and FLUC production in RLU min

Throughout this manuscript, the average rate for each LUC is shown in

blue (RLUC) and yellow (FLUC) bar graphs. The ratio of these rates was

determined from each culture, and these were averaged and shown in green bar

graphs throughout the manuscript.

LETTER RESEARCH

Extended Data Figure 4

Examination of leaky expression and cryptic

promoter activity. a, Traces of LUC production from the wild-type PSIV

IRES-containing construct without induction with IPTG. Both RLUC and

FLUC are produced due to ‘leaky expression’ of mRNA, a common observation

with pET30a bacterial expression vectors. a–f,They-axis shows RLU.

b, Examination of the early time points of the traces from panel 1 show that

both RLUC and FLUC are expressed to a low level without induction, and thus

this leaky expression is not due to the IRES. c, Traces of wild-type PSIV

IRES with IPTG induction at time 5 0 (grey dashed line), showing the increase

due to induction. d, Traces of a construct with the RLUC-driving SDS knocked

out (Upstream SDS_K/O, same as in Fig. 1b), shown for comparison. e,To

check for cryptic promoter activity due to transcription from a site other than

the authentic T7 promoter, we cloned the full IRES-containing dual-LUC

cassette into a pET30a vector in which the T7 promoter was mutated from

59-TAATACGACTCACTATA-39 to 59-TAATGGTGTCTGAATTC-39

(T7_K/O). Both RLUC and FLUC are produced to low levels, indicating some

T7 promoter-independent expression exists in this vector, but the initial rates

of producing upon induction are very low (see f and g). f, Initial rates of

production of FLUC from the T7_K/O (induced), wild-type (uninduced), wild-

type (induced), and Upstream SDS_K/O (induced) constructs. Rates of

FLUC production from the T7_K/O and uninduced wild type are very low and

not sufficient to account for apparent initiation from the IRES upon induction.

This graph also illustrates the importance and utility of using the initial rates

of LUC production for analysis, rather than the entire curve or an arbitrary

later time point. g, Quantitated and graphed initial rate data for the four

constructs in this figure. Error bars represent 1 s.d. of the mean from three

biological replicates, except the uninduced control, which was done once.

RESEARCH LETTER

Extended Data Figure 5

PSIV IGR IRES sequence, secondary structure,

and design of mutants. a, Secondary structure of the full-length IGR IRES

from the PSIV. The specific changes that were introduced to generate the

mutants and constructs described and tested in the main text are shown.

For each, the altered region is boxed and the change is shown in red. For the

uAUG and uSTOP constructs, the start and stop codons are underlined. RLUC

and FLUC coding sequences are boxed cyan and yellow, respectively.

b, Constructs without the IRES that contain various wild-type or mutant SDS

and SDS-like sequences upstream of the FLUC open reading frame.

c, Construct containing just domain 3 of the PSIV IGR IRES.

LETTER RESEARCH

Extended Data Figure 6

Contributions of region upstream of AUG to

initiation activity. a, Diagram of constructs tested and traces of FLUC and

RLUC production. The y-axis shows RLU. b, Quantitated initial rates from

these constructs. Results from CSFV IRES (negative control) shown for

comparison. ‘Downstream SDS’ contains an SDS driving FLUC production

(in place of the IRES), ‘Downstream SDS-like’ contains the purine-rich

sequence in place of the IRES and driving FLUC production. In ‘Downstream

SDS-like_K/O’, this purine-rich sequence has been replaced by a pyrimidine-

rich sequence. A PSIV IRES construct in which both pseudoknots are disrupted

and the purine-rich SDS-like sequence just downstream of the IRES is

mutated has essentially the same activity as the CSFV IRES (Downstream SDS-

like_K/O1PK11PK2_K/O). Error bars are 1 s.d. from the mean of three

biological replicates.

RESEARCH LETTER

Extended Data Figure 7

The position of domain 3 in the full-length PSIV

IGR IRES

N 70S structure. Crystal structure of a full-length PSIV IGR IRES

bound to T. thermophilus 70S ribosomes. Cyan, small subunit; red, PSIV

IRES domain 3; black, unbiased Fourier difference F

2 F

map for domain 3

in the P site of the small subunit. The large subunit and domain 112 are

not shown.

LETTER RESEARCH

Extended Data Figure 8

Luciferase activity time courses for various

constructs. a, Time-course traces for constructs and bar graphs shown in

Fig. 3. b, Time-course traces for constructs and bar graphs shown in Fig. 4.

Error bars are 1 s.d. from the mean of three biological replicates. a, b,They-axis

shows RLU.

RESEARCH LETTER

Extended Data Figure 9

Quantitated data for various constructs in the

context of the PK11PK2_K/O mutation. a, Combination of knocking out the

RLUC SDS (Upstream SDS_K/O) with the PK2_K/O or PK11PK2_K/O.

Initial rates of RLUC are greatly diminished. Rates of FLUC are lower, but less

diminished than RLUC. This is probably attributable to the decreased

competition for ribosomes and the presence of the SDS-like sequence upstream

of the FLUC open reading frame and not to robust initiation on the IRES. b,The

PK11PK2_K/O dramatically reduced the initial rate of FLUC production

on the IRES with the F-SHIFT(21) mutation. c, The PK11PK2_K/O

dramatically reduced the initial rate of FLUC production on the IRES with the

F-SHIFT(22) mutation. d, The PK11PK2_K/O dramatically reduced the

initial rate of FLUC production on the IRES with the uSTOP and uAUG

mutations. Error bars are 1 s.d. from the mean from three biological replicates.

LETTER RESEARCH

Extended Data Table 1

Initial rates of RLUC and FLUC for all constructs tested and crystallographic data collection, phasing and refinement

statistics

a, Raw values are shown for all constructs tested. All values are the mean of three independent experiments 6 1 s.d. from the mean, except for the uninduced control that was done once. WT, wild type.

b, Crystallographic statistics.

* Values in parentheses are for highest-resolution shell.

{ R

meas

is R

meas

as reported by XDS

{ CC(1/2) is the percentage of correlation between intensities from random half-data sets as defined previously

RESEARCH LETTER