Shulin packages axonemal outer dynein arms for ciliary targeting

Shulin packages axonemal outer dynein arms for

ciliary targeting

Girish R. Mali

, Ferdos Abid Ali

, Clinton K. Lau

, Farida Begum

, Mark Skehel

, and Andrew P. Carter

1,*

Structural Studies Division, MRC Laboratory of Molecular Biology, Cambridge, United Kingdom

The main force generators in eukaryotic cilia and ﬂagella

are axonemal outer dynein arms (ODAs). During cilio-

genesis, these ~1.8 MDa complexes are assembled in the

cytoplasm and targeted to cilia via an unknown mecha-

nism. Here we use the ciliate Tetrahymena to identify two

novel factors (Q22YU3 and Q22MS1) which bind ODAs

in the cytoplasm and are required for their delivery to

cilia. We show that Q22YU3, which we name Shulin,

locks the ODA motor domains into a closed conformation

and inhibits motor activity. Cryo-EM reveals how Shulin

stabilizes this compact form of ODAs by binding to the

dynein tails. Our ﬁndings provide a molecular explana-

tion for how newly assembled dyneins are packaged for

delivery to the cilia.

Motile cilia play essential roles that range from setting up

the left-right body axis to clearing mucus from the lungs (1).

These slender cellular projections contain an axoneme built

of microtubule doublets. Ciliary beating is powered by ar-

rays of inner and outer dynein arm motors that slide adjacent

doublets past each other (2). The outer dynein arms (ODAs)

are the main force generators in cilia and the most frequently

mutated components in human motile ciliopathies (3). ODAs

are multi-subunit complexes (4), which are pre-assembled in

the cytoplasm by a collection of nine dynein axonemal as-

sembly factors and associated chaperones (4, 5). Following

assembly, ODAs are targeted to cilia, where the intraﬂagel-

lar transport (IFT) machinery carries them to their docking

sites (6, 7). However, the mechanism of ODA delivery to the

cilia and whether any additional factors are required for this

process are both unknown.

To identify potential ciliary targeting factors, we puriﬁed

newly-assembled ODAs from the cytoplasm of the protozoan

ciliate Tetrahymena thermophila. We de-ciliated Tetrahy-

mena to remove pre-existing axonemes and trigger new ODA

synthesis (8) (Figure 1A). ODA complexes, containing a

FLAG-tagged copy of the intermediate chain IC3, were ex-

tracted and separated from other assembly intermediates by

size exclusion chromatography (SEC). Two factors co-eluted

with the new fully-assembled ODAs and were identiﬁed by

mass spectrometry (MS) as Q22MS1 and Q22YU3 (Figure

1B, Figure S1A). We also performed label-free quantitative-

MS on the immunoprecipitated IC3 subunit and detected an

equivalent fold enrichment of both factors relative to other

ODA subunits (Figure S1B, Table S1). Taken together,

these data suggest Q22MS1 and Q22YU3 interact tightly

Co-ﬁrst authors

with ODAs in the cell body.

These novel factors lack known functions and have not

previously been linked to motile cilia. Q22YU3 shares

24% identity to human C20ORF194 (Figure S2) whereas

Q22MS1 has a unique domain architecture and no ortholog

outside of Tetrahymena. To investigate their roles, we gener-

ated Tetrahymena knockout strains for each factor (Figure

S3A). Both strains showed an ~2-fold decrease in swim-

ming speed compared to wildtype (Q22YU3: 10.6 ± 12

µm/s, Q22MS1: 11.88 ± 12.6 µm/s, WT: 22.5 ± 16.9 µm/s;

mean ± SD) suggesting defects in cilia movement (Figure

1C). Mutants also had decreased accumulation of food vac-

uoles and a higher frequency of cytokinetic defects, which are

hallmarks of defective cilia motility in Tetrahymena (9, 10)

(Figure S3B, C). We found the lengths and numbers of cilia

in our knockouts were similar to wildtype suggesting our ob-

servations were not due to defects in ciliogenesis (Figure

S3D, E). However, high-speed imaging showed mutant cilia

beat slowly (movie S1), similar to a temperature-sensitive

mutant with reduced ODAs in cilia (11) (movie S2). We

therefore used immunoﬂuorescence to test if loss of Q22YU3

and Q22MS1 affects ODA targeting to cilia. Staining with an

antibody against ODAs showed marked reductions in their

levels in cilia of mutant strains compared to the wildtype

(Figure 1D, E, Figure S3F). Together, our data suggest that

loss of Q22YU3 or Q22MS1 result in defective ciliary move-

ment due to reduced delivery of ODAs to the cilia.

It has been proposed that ODAs need to be held in an inac-

tive state during transport into the axoneme (4). We there-

fore tested whether Q22YU3 and Q22MS1 inhibit dynein

motor activity. We expressed both factors recombinantly

and assayed their effect on the microtubule gliding activity

of ODAs puriﬁed from axonemes (Figure 2A). In the ab-

sence of Q22YU3 and Q22MS1, ODAs translocated micro-

tubules at 1.39 ± 0.6 µm/s (mean ± SD). Microtubule gliding

was severely compromised in the presence of both factors to-

gether (0.15 ± 0.15 µm/s) or with Q22YU3 alone (0.1 ± 0.15

µm/s). Q22MS1 reduced microtubule gliding velocities to a

lesser extent (0.56 ± 0.76 µm/s). In contrast, addition of both

factors to cytoplasmic dynein-1 did not signiﬁcantly alter its

microtubule gliding velocity (0.76 ± 0.47 µm/s for dynein-

1 alone vs 0.69 ± 0.27 µm/s with both factors). These data

show Q22YU3 is sufﬁcient to speciﬁcally inhibit ODA activ-

ity.

Tetrahymena ODAs contain three dynein heavy chains and,

* Correspondence: [email protected]

Mali et al. | bioRχiv | August 20, 2020 | 1–28

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure 1. Q22MS1 and Q22YU3 deliver ODAs from cytoplasm to cilia. (A) Scheme used to identify novel interactors of ODAs assembled in the cell body. (B) SDS-PAGE of

ODA puriﬁed from the cell body by IP-SEC showing co-elution with Q22MS1 and Q22YU3, HC: Heavy chains, IC: Intermediate chains. (C) Cell swimming velocity comparing

wildtype (WT n=108) and mutant strains (Q22YU3∆ n=102 and Q22MS1∆ n=110). (D) Ratio of ODA/Tubulin immunoﬂuorescence intensity along individual cilia (WT n=118,

Q22YU3∆ n=104, Q22MS1∆ n=129, 3-10 cilia from 14-17 cells/genotype). (E) Representative cells showing immunoﬂuorescence for ODA and tubulin (quantiﬁed in D). Scale

bars:10 µm. Error bars show standard deviation; ns=not signiﬁcantly different, ****p≤0.0001 (ANOVA with Tukey’s test for multiple comparisons).

when puriﬁed from axonemes, show an open bouquet confor-

mation with the heavy chain motor domains separated (12).

However, when we used negative stain electron microscopy

(EM) to image ODAs puriﬁed from the cytoplasm, we no-

ticed ~40% of intact particles displayed a ’closed’ conforma-

tion where the motor domains are clustered, and the tails are

compacted (Figure S4). This closed conformation resembles

a form previously observed only after cross-linking (12). To

identify the factor responsible, we reconstituted ODAs ex-

tracted from axonemes with Q22MS1 and Q22YU3. Both

factors form stable complexes with ODAs either together or

individually (Figure 2B, Figure S5A). Whereas ODAs on

their own were entirely in the open conformation (Figure

2C, D), in the presence of both factors 50 ± 8.3% (mean

± SD) of particles were closed, similar to the fraction ob-

served for ODAs puriﬁed from the cytoplasm. ODAs bound

to Q22MS1 alone were closed only 7.7 ± 5.0% of the time.

In contrast, in the presence of Q22YU3 alone, 60 ± 11.4%

of ODAs were closed (Figure 2C, D, Figure S5B-F). Col-

lectively, our ﬁndings suggest that Q22YU3 inhibits ODAs

by holding the three heavy chains together into a closed con-

formation. We therefore propose to name this novel protein

Shulin (Sanskrit: one that holds the trident).

To elucidate how Shulin closes ODAs at a molecular level,

we determined the structure of the reconstituted Tetrahymena

ODA-Shulin complex by cryo-EM. The resolution of our

overall structure is limited to 8.8 Å due to its ﬂexibility. How-

ever, focused classiﬁcation and local reﬁnement produced a

series of sub-region maps ranging from 4.3-5.9 Å in global

resolution (Figure 3A, Figure S6). The central portion of

the Shulin region map has a local resolution range of 3.2-4.2

Å (Figure S7) enabling de novo building of Shulin and its in-

teractions (Figure 3A). In combination with MS to identify

the ODA subunit composition (Figure S8), our maps allowed

us to assign the positions of the three heavy chains (Dyh3,

Dyh4, Dyh5), two essential intermediate chains (ICs: Dic2,

2 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure 2. Q22YU3 binding inhibits ODAs by clustering motors. (A) Microtubule gliding velocities. Individual gliding events from three technical replicates/sample are

plotted (ODA n=159, ODA+YU3+MS1 n=136, ODA+YU3 n=146, ODA+MS1 n=94, Dyn1 n=136, Dyn1+YU3+MS1 n=76). YU3: Q22YU3, MS1: Q22MS1, Dyn1: human

cytoplasmic dynein 1. Error bars show standard deviation; ns=not signiﬁcantly different, ****p≤0.0001 (ANOVA with Tukey’s test for multiple comparisons). (B) Axonemal-

puriﬁed ODA reconstituted with recombinant Q22YU3 and Q22MS1. SDS-PAGE gel of SEC peak fraction. (C) Representative 2D class averages showing the distribution of

open (purple) and closed (green) ODA particles from ODAs alone and reconstituted with factors. Scale bars = 10 nm. (D) Quantiﬁcation of closed and open particles shown

in (C) represented as percentage. Error bars show standard deviation.

Dic3) and 11 light chains (LCs) (Figure 3B, Figures S6-S8).

In our structure, the motor domains are clustered in a closed

conformation (Figure 3B) consistent with the negative stain

data. At the core of the structure are the Dyh3 (-HC) and

Dyh4 (-HC) heavy chains, which are conserved across all

eukaryotes with motile axonemes (13). They form a het-

erodimer held together by an N-terminal dimerization do-

main in an arrangement that is similar to cytoplasmic dyneins

(14, 15). The third heavy chain, which is only found in ciliate

and algal ODAs, is Dyh5 in Tetrahymena (-HC equivalent to

the -HC in the alga Chlamydomonas). Our structure shows

that Dyh5 is much shorter than the other heavy chains and is

anchored to Dyh4 halfway along its length. The N-terminus

of Dyh5 contains a Kelch-type -propeller domain that sits

on the helical bundles of Dyh4 (Figure 3C). The peripheral

attachment of this third heavy chain explains why its loss in

Chlamydomonas is largely tolerated (16).

In their tail regions, Dyh3 and Dyh4 wrap round the globu-

lar WD40 domains of the intermediate chains and Dyh4 also

binds to a small density consistent with the thioredoxin-like

Lc3 light chain (Figure 3D, Figure S9A). The intermediate

chains have long N-terminal extensions which are held to-

gether by a tower of light chains consisting of a Lc7/Lc7b

heterodimer, three dimers of Lc8 orthologs and at the end,

bent over to one side, a Tctex like heterodimer of Lc2a/Lc9

(Figure 3D, Figure S9B). Based on side-chain density we as-

signed the positions of Lc8 and its orthologs: Lc8d, Lc8e and

an unnamed Lc8-like protein (UniProt ID: Q22R86) which

we call Lc8f. Our MS analysis showed the additional pres-

ence of Lc10 and Lc8b which we tentatively assigned to

the remaining two positions. The bent arrangement of the

Lc2a/Lc9 heterodimer is stabilized by the Dic2 N-terminus,

which loops out from where it contacts Lc2a and wedges be-

tween Lc8d and Lc8e (Figure S9B).

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 3

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure 3. Cryo-EM reconstruction shows architecture of closed ODA. (A) Overview of the closed ODA bound by Shulin with head (purple) and tail (blue) maps docked in

an overall map (grey). Maps obtained after masked reﬁnements are shown for the head region containing densities for Dyh3,4 and 5 motor domains and the tail map contains

a docked Shulin-region map (green). Representative cryo-EM densities are shown. (B) Cartoon and ﬁltered surface representation of all modeled subunits. (C) Dyh5 binds

Dyh4 via its N-terminal Kelch domain (inset). HB: Helical bundles, NDD: N-terminal dimerization domain. (D) DIC N-terminal extensions bind dimers of LCs forming a LC

tower and followed by globular WD40 domains that contact Dyh3 and Dyh4. Heterodimers of Lc7/7b and Lc8b/Lc10 are tentatively assigned (*). Lc3 sits on Dyh4 and is not

part of the LC tower.

In the motor region, all three heavy chains are locked in the

pre-power stroke conformation of their catalytic cycle (17)

with their force producing linker domains bent through 90°

(Figure S10A, B). The density suggests that the coiled-coil

stalks of each motor domain are angled to interact with each

other close to their microtubule binding domains (Figure 3A,

B, Figure S10B). Clustering of motor domains is further sta-

bilized by interactions between the Dyh3 and Dyh4 linkers,

between the Dyh4 AAA4 and the elbow of the Dyh3 linker

and between the Dyh5 AAA3 and Dyh3 AAA4 (Figure

S10C, D). This clustered conformation is distinct to the one

ODAs adopt upon docking onto ciliary doublets where their

motor domains are stacked parallel to each other and free to

undergo their catalytic cycle (18). Thus, the closed confor-

mation is an inactive state of ODAs prior to their ﬁnal incor-

poration into cilia.

Our Shulin structure shows that it contains N-terminal do-

mains (N1, N2) which are related to the aminopeptidase P

domain of Spt16, a core component of the histone chaper-

one FACT (Figure 4A). We built the middle (M) domain de

novo, revealing that it adopted a pleckstrin homology (PH)

fold akin to the Spt16 C-terminus. Therefore, the N-terminal

half of Shulin bears high structural homology to Spt16 (19).

Shulin’s C-terminal domains (C1 and C2) are homologous to

the bacterial GTPase YjiA (20). C1 has a Ras-like fold and

C2 comprises of a ﬁve-stranded -sheet. There is a nucleotide

between C1 and C2, which plays a structural role holding

the two domains together (Figure S11A). Shulin ends with

a long C-terminal ﬁnger with a helix-loop arrangement that

projects away from the core of the molecule (C3) (Figure

4A).

Shulin stabilizes the closed conformation of ODAs by bind-

ing all three heavy chains and the LC tower (Figure 4B). It

makes its most extensive interactions with Dyh3 (3216 Å

4 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure 4. Characterization of Shulin structure and its mechanism of ODA inhibition. (A) Domain architecture of Shulin. N-terminal (N1, N2) and Middle (M) domains

bear homology to FACT complex core subunit Spt16. C-terminal (C1, C2) domains are similar to GTPase YjiA and are followed by a C-terminal ﬁnger (C3). (B) Cartoon and

ﬁltered surface representation with all contacts between Shulin and ODA subunits highlighted in green spheres. (C) Shulin’s N1 domain contacts helical bundles proximal to

the linker in Dyh3 tail. The C3 ﬁnger projects out to contact Dyh3 AAA1(S) (insets). (D) Shulin’s N1 domain contacts Dyh5 helical bundles and its N2 domain touches the

Kelch domain. Shulin contacts Dyh4 just below Dyh5 Kelch-domain (insets).

surface area). Shulin’s N1 domain contacts multiple sites in

the Dyh3 tail and its C3 ﬁnger binds AAA1S of the Dyh3

motor domain (Figure 4C). These contacts bridge the Dyh3

tail and motor holding them in a rigid conformation (Figure

S7). Shulin can only make these connections if the motor is

in its pre-power stroke conformation, suggesting it directly

locks Dyh3 into its closed state (Figure S11B).

Shulin holds the other two motor domains in their closed

conformation indirectly by stabilizing the contacts they make

with Dyh3 and each other. Its N2 domain makes a small con-

nection (313 Å

) to Dyh4 close to where the Dyh5 Kelch

domain is docked (Figure 4D). This interaction holds Dyh3

and Dyh4 together and reinforces a contact between the heli-

cal bundles in their tail regions (Figure S11B). This, in turn,

supports the previously-described connections between their

motor domains (Figure S10). Shulin’s connection to Dyh5,

via its N1 domain, is also small (292 Å

), but sufﬁcient to

stabilize the Dyh5 linker binding to the Dyh3 motor domain

and motor-motor contacts between Dyh4 and Dyh5 (Figure

S10E). In the light chain tower the M-domain of Shulin con-

tacts Lc8e and its C1-domain contacts Lc8d and an -helix in

the Dic2 N-terminus (Figure S11C). These contacts stabi-

lize packing of the LC tower against the Dyh3 tail (Figure

S11D). Taken together, Shulin makes contacts with multiple

ODA subunits and stabilizes the interactions between them

that hold the motors in a closed conformation.

Here, we identify two proteins, Q22MS1 and Shulin, which

co-purify with ODAs in the cytoplasm and are required for

their delivery to cilia. Q22MS1 is a 222 kDa protein con-

taining a catalytically inactive nucleoside diphosphate kinase

(NDK) domain. A homologous NDK domain is found in the

recently identiﬁed Xenopus protein DAAP1 (21). DAAP1

has also been implicated in ODA delivery to cilia and lo-

calizes to membrane-less organelles involved in dynein as-

sembly. Interestingly however, there is no homology be-

tween Q22MS1 and DAAP1 outside the NDK domain and

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 5

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

the mammalian orthologs of DAAP1 lack the NDK-domain

completely.

Shulin shuts down ODA motor activity, suggesting it is the

proposed inhibitor (4) required during targeting of ODAs to

the cilia. Unlike the cytoplasmic dyneins which are auto-

inhibited (14, 15) ODAs rely on Shulin to enforce inhibition.

Inactivating ODAs may be important to prevent them from

escaping prematurely from cilia. Using immunostaining we

found that Shulin localizes to regenerating motile cilia 30-

minutes after deciliation (Figure S12A, C). This is the stage

of ciliogenesis when ODAs are being actively imported and

incorporated (8). In contrast, Shulin is predominantly cyto-

plasmic in cells with fully assembled cilia (Figure S12B, D).

This suggests, Shulin travels with ODAs during ciliogenesis

until they reach their ﬁnal axonemal location.

In addition to its inhibitory role, Shulin may directly tar-

get ODAs to cilia. A candidate for the delivery process is

the small G-protein Arl3 which regulates targeting of nu-

merous ciliary cargo (22). The human ortholog of Shulin,

C20ORF194, is reported to bind the GTP-bound form of

Arl3, which speciﬁcally localizes to cilia (23). Thus, Shulin

may serve dual purposes of packaging and targeting ODAs to

cilia.

Materials and methods

Tetrahymena thermophila strain engineering and pheno-

typic analyses

Tetrahymena thermophila wildtype CU428 strain (Tetrahymena

Stock Center) was used in this study. Cultures were maintained in

SPP medium (1% bacto proteose peptone (Difco), 0.2% glucose,

0.1% yeast extract, 33 µM FeCl

). Transgenic lines were gen-

erated using biolistic transformation as previously described (24).

For tagging IC3 polypeptide with tandem ZZ and FLAG tags, a

construct bearing homology arms to the gene region upstream of

the stop codon and the 3’ UTR of DIC3 (TTHERM_00079230)

ﬂanking a Neomycin resistance cassette, with codon optimized se-

quences for the tags was used. DNA was precipitated onto 10-

micron gold carriers for biolistic bombardment of the macronucleus

using a Gene Gun (Bio-Rad). For disruption of Q22YU3/SHULIN

(TTHERM_00122270) and Q22MS1 (TTHERM_00030520), con-

structs with homology arms to the 5’ UTR and 3’ UTR of the respec-

tive genes ﬂanking the resistance cassette were generated. Trans-

formants were transferred to SPP medium for recovery and the pro-

moter driving the Neomycin resistance gene was switched on by ad-

dition of cadmium chloride (1 µM). After recovery, bombarded cells

were transferred into 96-well plates to isolate transformed clones.

Cultures were passaged every few days into medium containing in-

creasing concentrations of Paromomycin for phenotypic assortment

of transformants. Successful generation of tagged transgenic strains

was assayed by performing genomic PCRs spanning the Neo3 cas-

sette after several generations. Only transgenic strains would am-

plify this resistance gene. Immunoblotting and immunoﬂuorescence

with a monoclonal FLAG antibody (Flag M2 Sigma, 1:100 dilution)

further conﬁrmed the endogenous knock-in of the epitope tag at the

carboxy terminus of the IC3 polypeptide.

The knockout mutant strains tolerated up to 20-50 mg/ml of Paro-

momycin concentration. Genomic PCRs spanning Exons 1 to 3

of Q22YU3 (Exon 1 forward primer: atgaatttaaattttgcatgtcttcaataag,

Exon 3 reverse primer: ttatacatcatgaactgtacaatcacttgg) and Q22MS1

(Exon 1 forward primer: atgtttggatttgaagatatccattactaacc, Exon 3

reverse primer: attagaggcttagtgaacatgtcttcgtc) conﬁrmed disruption

of both loci as only wildtype controls resulted in a robust ampli-

con whereas both mutants failed to generate a strong PCR product

(ﬁg. S3A). A control PCR for -heavy chain gene was performed

to verify the integrity of the genomic DNA. Additionally, immunos-

taining Q22YU3/SHULIN cells with a custom polyclonal anti-

body against Shulin (Eurogentec, 1:100 dilution) conﬁrmed loss of

protein as well as serving as antibody validation (Figure S12C, D).

For assessing ciliary defects in Q22YU3/SHULIN and

Q22MS1 mutant strains, three main phenotypic assays were per-

formed. Cell images or movies were acquired using a QIClick cam-

era with QCapture software mounted onto a Leica DM IL LED

microscope. Imaging was performed at room temperature. Im-

munoﬂuorescence images were acquired using LSM710 confocal

microscope. Videos of cells swimming close to the plane of imag-

ing (closest to the slide) were acquired at 10 frames per second for

20-40 seconds using a 20x objective. High speed videos to visualize

cilia beating were acquired by digitally magnifying on individual

cells using a 100x objective at 10 frames per second. All cellular

phenotyping was done using FIJI (25). Cell velocity was measured

using MTrackJ plugin (26). Cell paths were manually traced, and

cell velocity was calculated as a function of distance traversed in a

given time frame. Food vacuoles were manually counted in phase

contrast images. Cilia numbers were counted using central confo-

cal slices in the plane of both the macro and micronucleus. Images

were thresholded to segment cilia around the cell circumference for

counting using FIJI. Cilia lengths were measured by drawing a line

along an individual cilium and measuring its distance. Lengths of

5-15 randomly selected cilia from 14-22 cells, from replicate stain-

ing experiments were measured. Cilium lengths per cell were av-

eraged and plotted. Cytokinesis defects were scored in images of

cells stained with acetylated -tubulin (SantaCruz, sc-23950, 1:250

dilution) to mark the cilia and demarcate the cell shape and DAPI

to stain for the nuclei. Cells with more than one oral apparatus

and/or macronucleus were counted for each genotype. To quan-

tify ciliary loss of ODAs in mutants, indirect immunoﬂuorescence

was performed using a custom generated polyclonal antibody raised

against the ODA holocomplex (Eurogentec, 1:150 dilution) and an

acetylated -tubulin antibody (SantaCruz, sc-23950, 1:250 dilution)

to mark the ciliary axoneme. The ODA antibody was validated by

the manufacturer with ELISA tests against the ODA holocomplex

antigen. Additional validation of speciﬁcity was performed using a

temperature sensitive OAD1 C11 mutant strain (Tetrahymena Stock

Center) with reduced ciliary ODA staining when grown at the re-

strictive temperature of 39°C (Attwell et al. 1992). Fluorescence

intensity values along the cilium were measured using plot proﬁle

tool, averaged and plotted in GraphPad Prism7.

Puriﬁcation of ODA complexes and interactors from cell

body

Large scale cultures of IC3: ZZ: 3xFLAG strains were grown to a

high cell density in SPP medium typically for 72 hours. Cultures

were starved in Tris-Acetate buffer for 2 hours to reduce numbers

of phagocytic vacuoles containing proteases. Cells were deciliated

with dibucaine hydrochloride (0.5 M). The extent of deciliation was

carefully monitored by visual inspection under a stereomicroscope

to ensure minimal cell lysis. Typically, within 5 minutes of adding

dibucaine most cells appeared to have lost their cilia. Dibucaine

concentration was diluted three-fold by adding more medium and

6 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

cells were pelleted. Cell pellets were washed in Tris-Acetate buffer

and lysed in Lysis Buffer (20 mM HEPES NaOH, pH 8.0, 50 mM

NaCl, 1 mM EDTA, 5 mM DTT, and 10% glycerol supplemented

with 0.1% Triton X-100, 0.2% IGEPAL CA-630, 1 mM PMSF, 5

µM proteasome inhibitor MG-132, and 3x Complete protease in-

hibitor tablets (Roche). Lysates were clariﬁed by ultracentrifuga-

tion at 70,000 rpm in a Ti70 rotor (Beckman) and ﬂown multi-

ple times over FLAG-M2 afﬁnity beads (Sigma) which were pre-

equilibrated in lysis buffer and packed in a gravity ﬂow column.

The beads were washed for at least 5 column volumes times in Wash

buffer (20 mM HEPES, pH 7.4, 50 mM NaCl, 1 mM MgCl

, 1 mM

TCEP, 10% glycerol and 0.1% IGEPAL). IC3-ZZ-3xFLAG contain-

ing complexes were eluted into 5 fractions by sequentially ﬂowing 5

bed volumes of elution buffer containing FLAG peptide. Efﬁciency

of elution was assessed by running SDS-PAGE gels and staining

with Instant Blue (Expedeon). Elution of desired ODA complexes

was deemed successful upon detection of high molecular weight

bands corresponding to dynein heavy chains. Eluted fractions con-

taining the highest concentration of complexes were further frac-

tionated over a Superose 6 increase 3.2/300 size exclusion column

(GE Healthcare) in GF50 gel ﬁltration buffer (25 mM HEPES pH

7.4, 50 mM NaCl, 1 mM MgCl

, 1 mM DTT, 0.1 mM ATP). FLAG

eluates and peak fractions from gel ﬁltration run were analysed by

mass spectrometry.

Puriﬁcation of ODA from cilia axonemes

Axonemal ODAs were puriﬁed as previously described (12). Large

scale wildtype Tetrahymena cultures were deciliated using dibu-

caine (as above). Deciliated cell pellets were discarded and cilia in

the supernatant were centrifuged at 13,500 x g at room temperature.

Cilia pellets were washed in Cilia Isolation Buffer (CIB: 20 mM

HEPES pH7.4, 100 mM NaCl, 4 mM MgCl

, 0.1 mM EDTA) and

centrifuged at 600 x g several times to remove cell bodies and mu-

cus. A ﬁnal high-speed spin at 13500 x g at 4°C yielded a pure cilia

pellet with a white ﬂuffy appearance. Cilia were de-membranated

by resuspending the pellet in CIB containing 0.25% Triton-X de-

tergent, freshly added protease inhibitors, 1 mM DTT and 200 mM

PMSF followed by a 30-minute incubation on ice. De-membranated

cilia axonemes were isolated by centrifugation at 17000 x g at 4°C.

Axonemes were washed in CIB buffer to remove residual deter-

gent and re-pelleted. Axoneme pellets were resuspended in high

salt buffer (20 mM HEPES pH7.4, 600 mM NaCl, 4 mM MgCl

0.1 mM EDTA, 1 mM DTT, 0.1 mM ATP, 200 mM PMSF) and in-

cubated for 30 minutes on ice to isolate dynein arms. The dynein

containing high salt extract was loaded onto 6 identical 5-25% su-

crose density gradients made in CIB and ODA arms were separated

from other axonemal complexes over 16 hours by centrifugation at

33,000 rpm in an SW40 rotor at 4°C. The following day, sucrose

gradients were manually fractionated into 500 µl fractions. Every

alternate fraction was resolved on an SDS-PAGE gel and stained

with instant blue. ODA isolation was deemed successful upon de-

tection of characteristic high molecular weight bands corresponding

to ODA heavy chain polypeptides over several of the denser frac-

tions towards the bottom of the gradient. Sucrose gradient fractions

containing ODA complexes were further puriﬁed over a MonoQ

5/50 anion exchange column (GE Healthcare) to separate out other

axonemal dynein species. ODA complexes eluting at ~300 mM salt

off the MonoQ column were veriﬁed for intactness and presence of

subunits by a further gel ﬁltration step, negative stain electron mi-

croscopy and mass spectrometry analyses. ODA complexes puriﬁed

as above were used in all biochemical reconstitution experiments

and subsequent cryo-EM studies.

Insect cell expression and puriﬁcation of Q22MS1 and

Q22YU3/Shulin

Gene sequences coding for Tetrahymena thermophila Q22MS1

(TTHERM_00030520) and Q22YU3 (TTHERM_00122270;

C20ORF194-like) were codon-optimized and synthesized (Epoch)

for expression in Spodoptera frugiperda derived Sf 9 cells. Codon

optimized sequences were sub-cloned into pACEBac1-derived

vectors containing C-terminal 2xStrep tag. The following con-

structs were generated pACEBac1-Q22MS1-Psc-2ŒStrep and

pACEBac1-Q22YU3-Psc-2ŒStrep. Baculoviruses for individual

expression of Q22MS1 and Q22YU3/Shulin were prepared using

the insect cell-baculovirus system. Cells expressing recombinant

proteins were harvested 48 hours after infection and lysed in

50 ml cell lysis buffer (20 mM Hepes-NaOH pH 7.2, 100 mM

NaCl, 2 mM MgAc, 1 mM EDTA, 10% (v/v) glycerol, 1 mM

DTT). Cells were mechanically lysed in a 40 ml Dounce-type

homogenizer (Wheaton) using 15-25 strokes. Lysates were clariﬁed

by ultracentrifugation at maximum speed in a Ti70 rotor (503,000

x g) for 45 min, 4°C (Beckman Coulter). Clariﬁed lysates were

poured several times over 0.5-1 ml Streptactin resin (IBA) which

was applied into a gravity ﬂow column and pre-equilibrated in lysis

buffer. The resin was washed for 20 column volumes to remove

non-speciﬁcally bound contaminants. Recombinant proteins were

eluted off the resin in ﬁve fractions over sequential incubations in

an elution buffer (lysis buffer containing 3 mM D-desthiobiotin).

Eluates were resolved on an SDS-PAGE and stained with Instant

Blue to assess the purity of the recombinant proteins. Recombinant

proteins eluting off the Streptactin beads were further cleaned over

gel ﬁltration using GF150 (25 mM HEPES pH 7.4, 150 mM NaCl,

1mM MgCl

, 1 mM DTT, 0.1 mM ATP) buffer. Proteins were

snap frozen in liquid nitrogen and stored at -80°C for use in all

biochemical reconstitutions which were performed at 4°C.

Reconstitution of ODA with Shulin and/or Q22MS1

ODA complexes (~0.5-1 mg/ml) puriﬁed over a MonoQ col-

umn were mixed with 10-25x molar excesses of puriﬁed

Q22YU3/Shulin, Q22MS1 (~1-1.5 mg/ml) or both. Complexes

formed by overnight dialysis into 50 mM or 150 mM NaCl buffer

were used for negative stain EM analyses and complexes reconsti-

tuted by dialysis into 150 mM salt buffer were used for cryo-EM

grid freezing and analyses. Complex formation was assessed by

fractionating dialysates over a Superose 6 increase 3.2/300 size ex-

clusion column (GE) in GF50 (25 mM HEPES NaOH pH7.4, 50

mM NaCl, 1mM MgCl

, 1 mM DTT, 0.1 mM ATP) or GF150

(25 mM HEPES NaOH pH 7.4, 150 mM NaCl, 1mM MgCl

, 1

mM DTT, 0.1 mM ATP) buffer. Fractions spanning the entire col-

umn volume were resolved on an SDS-PAGE gel and stained with

Coomassie or SYPRO Ruby gel stain (Bio-Rad). The primary peak

consisted of ODA subunits with bound factors conﬁrming success-

ful reconstitution. Secondary peaks contained molar excesses of

individual proteins unbound to ODAs.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 7

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Microtubule gliding assays and quantiﬁcation

Gliding assays were performed as previously described (27). Micro-

tubules were polymerized at 37°C using Alexa-647 and unlabeled

tubulin at 3 µm and 11 µm concentration respectively in polymer-

ization mix (BRB80: 80mM potassium PIPES pH6.8, 1mM MgCl

and 1mM EGTA with 10mM GTP). Polymerized microtubules were

stabilized with 2 µM Taxol in BRB80 (Sigma T1912). 10-20 µl of

freshly prepared or freshly thawed ODA at ~100 µg/ml concentra-

tion was applied to a ﬂow chamber and allowed to adhere to glass

for 2 min at room temperature. Flow chamber was washed in buffer

(50 mM KAc, 10 mM HEPES pH 7.4, 4 mM MgAc, 1 mM EGTA)

containing 1% BSA. Taxol stabilized microtubules were ﬂowed in

with a motility mix (20 mM HEPES pH 7.4, 5 mM MgSO

, 1 mM

DTT, 1 mM EGTA) and allowed to bind to motors. Finally, motil-

ity mix containing 1mM ATP was ﬂowed in prior to TIRF imaging.

Imaging was performed at room temperature using a Nikon micro-

scope with a 100x oil-immersion objective (Nikon, 1.49 NA Oil,

APO TIRF).

The imaging system used the 100 mW 641 nm (Coherent Cube)

laser. Images were acquired with a back illuminated EMCCD cam-

era (iXonEM+ DU897E, Andor, UK) controlled with µManager

software. Imaging was performed with 100 ms exposures taken at 2

s intervals, one pixel = 0.16 x 0.16 µm with a pixel size of 160 nm.

For testing effect of factors, ODAs were pre-incubated on ice for

30 minutes with Q22YU3/Shulin, Q22MS1 or both in 10-25x mo-

lar excess and these complexes were applied to the ﬂow chamber as

above. These molar ratios resulted in successful reconstitutions as

above and enforced closure of ODAs (by Shulin) and were therefore

also used in gliding assays. As control, full-length human cytoplas-

mic dynein-1 (Schlager et al. 2014) was used at 100 µg/ml with or

without both factors. Microtubule gliding velocities for each condi-

tion tested were calculated by manually tracking the leading edge of

moving microtubules using the FIJI plugin MTrackJ. The average

velocity for the track of each microtubule was used to calculate the

average velocity for the entire population of microtubules recorded.

Experiments were performed in triplicate technical repeats.

Negative stain electron microscopy analysis

Negative stain microscopy analyses were performed on ODAs from

axonemes, ODAs from cell bodies and ODA complexes reconsti-

tuted with Q22YU3/Shulin, Q22MS1 or both. In each case, 3 µl of

sample at ~0.05-0.1 mg/ml concentration were applied for 1 minute

to freshly glow-discharged 400 mesh copper grids coated with a

continuous carbon support layer (Agar Scientiﬁc) followed by ap-

plication of 2% uranyl acetate for a minute and air-dried after wick-

ing away excess liquid. For statistical analysis of open versus closed

ODA bouquets, triplicate datasets per condition were collected man-

ually on a FEI Spirit T12 microscope (equipped with Gatan 2K Œ

2K CCD (model 984) operated at 120 kV with a 1-1.5 second expo-

sure and a pixel size of 3.64-3.5 Å/pix. For initial structural analysis

of cell body ODA complexes, large datasets were collected using

EPU on a FEI F20 microscope operated at 200 kV with 1s expo-

sure; 3.4 Å/pix. A typical dose of ~20 e

per Åand a range of defoci

between 0.5-1.5 µm were used.

Statistical analysis of open and closed ODA conformations

To quantify effect of factors on ODA structure, ODAs alone, ODAs

reconstituted with Q22YU3/Shulin, Q22MS1 or with both factors

were each freshly prepared in triplicates and applied to negative

stain grids. Micrographs were collected manually from random re-

gions of grids and processed using RELION 3 (28). CTF was es-

timated using GCTF (29). A small subset of manually picked par-

ticles from each dataset yielded class averages that were used to

autopick particles for that dataset.

Several rounds of 2D classiﬁcation were performed to remove

ambiguous particles representing ODAs which had fallen apart

or could not be assigned into closed or open classes. Only

intact three headed ODAs were further sub-classiﬁed. From

each of the three datasets per sample, a total of 13299 (ODA),

9118 (ODA+Q22YU3+Q22MS1), 9966 (ODA+Q22YU3) and 3610

(ODA+Q22MS1) intact ODA particles were used. These particles

were sub-classiﬁed and assigned into open versus closed conforma-

tions. Open conformation refers to ODAs with heads (motor do-

mains) far apart and tails open in a V-shape kinked to one side. In

contrast, a closed state is characterized by a tightly clustered ap-

pearance of heads and a compact tail straight in line with the heads.

Further rounds of sub-classiﬁcation were done, and raw particles

were visually inspected to assess that particles were being correctly

assigned into an open or closed class according to their conforma-

tion. All four datasets were analysed in triplicates (triplicate datasets

acquired from triplicate reconstitutions per sample) and for each set

mean frequency of open versus closed and standard deviations were

calculated.

For cell body ODAs, a large dataset of 279,106 particles acquired

from a cell body puriﬁcation of ODAs was sub-classiﬁed as above.

Non-ODA particles such as ribosomes, other cellular complexes and

broken ODAs were classed in an ambiguous class. Intact ODA parti-

cles were sub-classiﬁed as above until closed and open classes were

clearly distinguishable ( Figure S4).

Cryo-EM grid preparation

ODA were reconstituted with Q22YU3/Shulin using 1:10-1:25 mo-

lar ratios (ODA:Shulin; ODA at ~0.5-1 mg/ml and Shulin at ~1-1.5

mg/ml) as described above. Reconstituted complexes were puriﬁed

over a Superose 6 increase 3.2/300 size exclusion column SEC in

GF150 buffer and immediately crosslinked in 0.025% Glutaralde-

hyde (Sigma-Aldrich) for 30 minutes on ice followed by quench-

ing with 1 mM Tris-HCl (pH 7.4). This mild crosslinking with

0.025% glutaraldehyde minimized complex dissociation during grid

freezing. To assess that crosslinking did not cause gross artefacts

to reconstituted complexes, crosslinked complexes were negatively

stained and had an appearance indistinguishable to non-crosslinked

complexes freshly applied to EM grids.

ODA:Shulin complexes were applied at a concentration of ~0.1-

0.2 mg/ml to graphene oxide (GO) grids. GO grids were pre-

pared a day prior to freezing as previously described (30). Brieﬂy,

gold 300 mesh Quantifoil R2/2 holey carbon grids (Quantifoil Mi-

cro Tools) were glow discharged using an Edwards Sputter Coater

305B. Graphene oxide (GO) dispersion (Sigma-Aldrich; 2 mg/mL

in H2O) was diluted ten-fold with ddH2O to a ﬁnal concentration

of 0.2 mg/ml and subsequently spun down at 600 x g for ~15 sec

to remove large aggregates of GO ﬂakes. Three microliters of GO

ﬂake solution from the top was applied to grids. After incubation

for one minute with graphene oxide dispersion, the GO solution

was removed by blotting brieﬂy with Whatman No.1 ﬁlter paper

and washed by absorbing 20 µl ddH2O onto the GO coated side

twice and once on the back side of the grid with blotting steps in

between. Grids were air-dried and used the next day for cryo-EM

grid freezing without further glow discharging as GO grids were

already hydrophilic. Freezing was performed at 4°C with 100% hu-

midity. 3 µl of sample were applied to the GO side of the grids.

8 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

After a wait time of 45 seconds, excess liquid was blotted away for

2-2.5 seconds with Whatman ﬁlter papers pre-equilibrated in the hu-

midity chamber. Grids were immediately plunge-frozen into liquid

ethane using a Vitrobot IV (ThermoFisher Scientiﬁc). Grids were

transferred into grid-boxes and stored in liquid nitrogen for future

screening and data collection.

Cryo-EM data collection and initial processing of whole ODA

molecule

Electron micrograph movies were recorded using a Titan Krios

(Thermo Fisher Scientiﬁc) equipped with an energy ﬁltered K3

detector (Gatan) at 81,000x magniﬁcation in EFTEM mode. Six

datasets were collected at the LMB using Serial EM at a pixel size of

1.11 Å/pixel, 300 kV, 66 frames, 2.6 s exposure, ~52 e

/Å

. A script

was used to collect data in a 3x3 hole pattern, 3 images/hole, using

beam-tilt to speed up data collection. A further dataset was col-

lected at the Electron Bio-Imaging Centre (eBIC), Diamond Light

Source, UK using EPU v2.7 at 0.53 Å/pixel, 300 kV, 54 frames, 3 s

exposure, 54 e

/Å

(Table S2). Aberration-free image shift (AFIS)

collection was used to speed up data collection (4 images/hole).

Cryo-EM image processing

All image processing was performed using RELION-3.1 and soft-

ware wrapped within ( 28). Inter-frame motion in each movie was

corrected using RELIONs own implementation of motion correc-

tion as described above, using 5x5 patches and a B-factor of 150

Å applied to the micrographs (31). Defocus parameters were esti-

mated on non-dose weighted micrographs either using GCTF v1.18

(29) or CTFFIND4 v4.1.13 (32). For each individual dataset, par-

ticles were picked on non-dose weighted micrographs using Gau-

tomatch v0.56 using permissive picking parameters (cc_cutoff=0.1,

400 Å diameter) and projections from an initial structure of full-

length ODA. This initial model was obtained from a preliminary

round of processing of the eBIC and ﬁrst two LMB datasets where

the phi-dynein structure was used as a reference (EMD-3705).

Particles were extracted from dose weighted micrographs with bin

4 parameters (768-pixel box size re-scaled to 192, yielding a ﬁnal

pixel size of 4.24-4.44 Å/pixel). 2D classiﬁcation was subsequently

performed with 75-100 classes, T=4, 750 Å circular mask, limit-

ing resolution E-step to 15 Å and ignoring CTFs until ﬁrst peak.

A further 2-3 rounds of 2D classiﬁcation without alignment (50-70

classes) was performed to remove graphene oxide layer artifacts,

ice contamination and aggregated particles refractory to averaging.

Particles from 2D classes showing projections of recognizable ODA

views were selected and joined from all datasets (1,300,000 parti-

cles).

The combined particles were subjected to global auto-reﬁnement

with a loose mask around the whole ODA and an initial model of

the whole molecule ﬁltered to 50 Å giving a 15 Å structure. Con-

siderable ﬂexibility was observed in this overall structure (hereafter

referred to as overall-1), particularly the Dyh4 and Dyh5 motors

and the lower tail section. To resolve the tail and motors of ODA

separately, we employed a combination of focused classiﬁcation,

masked reﬁnement and signal subtraction as outlined in Figure S6.

All masks used were created using volumes of sub-regions gener-

ated in Chimera (UCSF) using ’volume eraser’ or ’color zone’ (33).

These sub volumes were low pass ﬁltered to 15 Å with a soft edge

and binary map extension (both 6-8 pixels).

Processing of full-length and Dyh4/Dyh5 motors

To improve upon the resolution of the full-length ODA structure,

the overall-1 reﬁnement data.star was used as input for masked 3D

classiﬁcation without alignment (5 classes, T=4). Particles from the

class showing the most complete density (evidence for Dyh4 and

Dyh5 at lower threshold levels) were selected for masked global

3D reﬁnement, yielding a 9.7 Åstructure. At this point particles

were re-extracted to their bin by 2 and unbinned parameters in par-

allel: 384-pixel box size at 2.22 Å/pixel and 768-pixel box size at

1.11 Å/pixel, respectively. These particles were used for local re-

ﬁnements, yielding full-length ODA structures that resolved to 8.9

Å (bin by 2) (overall-2) and 8.8 Å (unbinned) (overall-3; EMD-

11576). A mask was applied to the tail of the overall-3 map and

a local reﬁnement was performed resulting in a 6.7 Å map of the

entire ODA tail (EMD-11577). The overall-2 map provided higher

signal to noise ratio for the ﬂexible Dyh4 and Dyh5 motor domains

and was thus used to resolve these regions through signal subtrac-

tion and focused reﬁnements. To this end, particle subtraction was

performed by centering the subtracted images on a mask encom-

passing both Dyh4 and Dyh5 motors and re-boxing to 256 pixels

(2.22 Å/pixel). Subtracted particles were subjected to a local reﬁne-

ment, giving a an overall 12.9 Å structure of Dyh4-Dyh5 motors.

This reconstruction was used as the basis for signal subtraction of

Dyh4 and Dyh5 individually. Each motor was subsequently locally

reﬁned (Dyh4, 10.5 Å and Dyh5, 11.8 Å with no post processing)

and 3D classiﬁed without alignment (5 classes, T=50). A ﬁnal local

reﬁnement with particles from the best 3D classes (selection criteria:

ordered motor, presence of stalk and limited noise) was performed,

resolving to 5.0 Å (57,761 particles) and 5.6 Å (49,756 particles)

for Dyh4 (EMD-11582) and Dyh5 (EMD-11583, EMD-11584), re-

spectively.

Processing of the tail and Shulin region

To get high resolution information on the Shulin region, a mask for

the full tail was ﬁrst generated based on the overall-1 structure. Us-

ing this mask, a round of 3D classiﬁcation without alignment was

performed on bin by 4 particles (8 classes, T=8) with the data.star

from overall-1 as input. Particles from the class containing clear

density for the Shulin ﬁnger, mid- and low tail region were selected

for global reﬁnement, resolving to 9.0 Å. This was subsequently

used as an input for 3D classiﬁcation without alignment with a mask

focusing on the Shulin region (8 classes, T=100). Six classes con-

taining clear density for the Shulin region were selected for a lo-

cal reﬁnement that produced an 8.9 Å reconstruction. At this point,

123,484 particles were unbinned and re-boxed to a smaller 384-pixel

box size (1.11 Å/pixel). A more speciﬁc mask of Shulin was created

encompassing its core N-terminal and C-terminal domains, the C3

ﬁnger as well as contacts to the uppermost LC tower and portions of

the contacting Dyh3-5 tails. Masked local reﬁnement of this region

produced a 4.8 Å structure. Finally, the Shulin region reﬁnement

parameters were used for a round of 3D classiﬁcation without align-

ment to sort out remaining heterogeneity (5 classes, T=50). 43,338

particles from two overlapping classes were combined for two sep-

arate masked local reﬁnements of the Shulin region: Shulin region

and the DYH3 tail contact (4.6 Å; EMD-11580), and Shulin region

excluding C3 ﬁnger (4.3 Å; EMD-11579). A larger mask of the tail

was also applied to the earlier 123,484 subset of particles to get an

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 9

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

overview of the lower tail region (reﬁned to 5.9 Å after signal sub-

traction, re-centering and masked 3D classiﬁcation; EMD-11578).

Processing of the Dyh3 region

The overall-1 map indicates that Dyh3 is rigid relative to the two

other motors, enabling direct masked 3D classiﬁcation without

alignment of this motor and region of the upper tail (based on

overall-1 data.star, 8 classes, T=10). Selection of particles from the

best class and global 3D reﬁnement resulted in a 9.0 Å structure, at

which point particles were unbinned and re-boxed (512-pixel box

size). A tighter Dyh3 motor only mask was generated and used for

a round of local 3D reﬁnement, producing a 4.8 Å structure. This

was used as the basis for 3D classiﬁcation without alignment to sep-

arate out conformational heterogeneity (5 classes, T=50), resulting

in only one class showing complete density. 49,397 particles from

this class were selected for a ﬁnal round of local 3D reﬁnement and

re-centering in the box, yielding a 4.4 Å resolution structure (Dyh3

region; EMD-11581).

Model building and reﬁnement

Homology models were generated for ODA subunits using

PHYRE2 (34), using the sequences of chains found in mass spec-

trometry. These were supplemented by homology models from se-

quences for all ODA light chain subunits. Initially models were ﬁt

into density using rigid body ﬁtting, followed by jiggle ﬁtting in

Coot (35). For the dynein heavy chain, density in the motor do-

mains allowed for the distinction between Dyh3 and Dyh4. For

the LC tower, side-chain density allowed us to conﬁdently assign

four of the LC8-like light chains (W7XJB1_Lc8, Q24CE5_Lc8d,

Q24DI9_Lc8e, Q22R86 (named Lc8f), and the Tctex-like light

chains (A4VEB3_Lc9 and Q1HGH8_Lc2a). The roadblock light-

chains Lc7 and Lc7b were tentatively assigned based on their dif-

fering C-terminal sequence lengths. The ﬁnal two LC8-like chains

identiﬁed in the MS data were assigned to the remaining positions

based on their N-terminal sequence lengths. Models in higher reso-

lution density were manually reﬁned into maps using Coot (EMD-

11579, EMD-11581), rebuilding regions when necessary. Side-

chain resolution density also allowed us to distinguish the N-termini

of the two intermediate chains, Dic2 and Dic3. The orientation of

the two N-termini allowed us to distinguish the IC WD40 domains,

which were modeled. We could also assign the registry of Dyh3 and

Dyh4 in the tail regions that contacts Shulin (EMD-11580).

For Shulin, PHYRE2 initially generated two models. The N-

terminus residues (21-500 aligned with c5ce6A) were predicted to

adopt a fold similar to Spt16 from the FACT complex, whilst the

residues (726-1104 aligned with c1nijA) were predicted to fold sim-

ilar to the GTPase YjiA. These two domains were ﬁt into EMD-

11579 in Coot (35). We then rebuilt sections of both domains into

our map and built the middle domain of Shulin de novo. The C ter-

minal ﬁnger was ﬁt into lower resolution density, with the loops that

contact the Dyh3 motor domain built using Dyh3 region map EMD-

11581. Density for nucleotide between the C1 and C2 domains was

ﬁtted with a GTP analogue from PDB 2HF8, changed to GTP and

manually reﬁned in Coot. Once all the subunits were modeled or

built, the structure was split, with subunits reﬁned against the high-

est resolution maps using PHENIX (36) and REFMAC5 (37) (table

S3). Regions were reﬁned until their model validation statistics,

calculated using PHENIX, no longer improved. In other regions,

homology models were docked into density (EMD-11577, EMD-

11578, EMD-11582, EMD-11583, EMD-11584) then reﬁned using

PHENIX, including secondary structure restraints. For all three mo-

tor domains, microtubule binding domains were tentatively placed

based on the angles and registries of the stalks. All regions were

then re-assembled into one model, with boundaries reﬁned using

PHENIX. For the overall model, all side chains were removed for

deposition.

Mass spectrometry

Protein identiﬁcation by mass-spectrometry was done either using

in-gel or in-solution tryptic digestion. Three separate types of MS

analyses were performed. 1) For identifying novel interactors of cell

body ODAs, IC3-ZZ-FLAG pulldowns were performed on decili-

ated cells (as described above) in quadruplicates. Eluates were run

on SDS-PAGE gels, Coomassie stained and excised gel slices were

analysed by mass spectrometry. 2) For identifying proteins in the

cell body ODA peak fraction following pulldowns and gel ﬁltra-

tion, samples were resolved on SDS-PAGE and stained with SYPRO

ruby protein gel stain (Bio-Rad). Polyacrylamide gel slices contain-

ing the bands for ODA holocomplex and bound factors were pre-

pared for mass spectrometric analysis. 3) For precisely identifying

subunit composition of ODAs in cilia, IP/MS experiments as above

were performed on the isolated ciliary fraction of the IC3-ZZ-FLAG

strains. Additionally, MonoQ fractions containing ODAs puriﬁed

from cilia of wildtype strains (as described above) were tryptically

digested in-solution for mass spectrometric analysis. Both these lat-

ter mass spectrometry experiments identiﬁed the same subunit com-

position for ODAs.

For polyacrylamide gel slices (1-2 mm) containing the puriﬁed pro-

teins were prepared for mass spectrometric analysis by manual in

situ enzymatic digestion. Brieﬂy, the excised protein gel pieces were

placed in a well of a 96-well microtitre plate and destained with

50% v/v acetonitrile and 50 mM ammonium bicarbonate, reduced

with 10 mM DTT, and alkylated with 55 mM iodoacetamide. After

alkylation, proteins were digested with 6 ng/µL Trypsin (Promega,

UK) overnight at 37

rC. The resulting peptides were extracted in

2% v/v formic acid, 2% v/v acetonitrile. Protein samples in solution

were reduced with 10 mM DTT and alkylated with 50 mM iodoac-

etamide. Following alkylation, the proteins were digested with

trypsin (Promega, UK) at an enzyme-to-substrate ratio of 1:100, for

1 hour at room temperature and then further digested overnight at 37

rC following a subsequent addition of trypsin at a ratio of 1:20. The

digests were analysed by nano-scale capillary LC-MS/MS using a

Ultimate U3000 HPLC (ThermoScientiﬁc Dionex, San Jose, USA)

to deliver a ﬂow of approximately 300 nL/min. A C18 Acclaim

PepMap100 5 µm, 100 µm x 20 mm nanoViper (ThermoScientiﬁc

Dionex, San Jose, USA), trapped the peptides prior to separation

on a C18 Acclaim PepMap100 3 µm, 75 µm x 150 mm nanoViper

(ThermoScientiﬁc Dionex, San Jose, USA). Peptides were eluted

with a gradient of acetonitrile. The analytical column outlet was

directly interfaced via a modiﬁed nano-ﬂow electrospray ionization

source, with a hybrid dual pressure linear ion trap mass spectrometer

(Orbitrap Velos, ThermoScientiﬁc, San Jose, USA). Data dependent

analysis was carried out, using a resolution of 30,000 for the full

MS spectrum, followed by ten MS/MS spectra in the linear ion trap.

MS spectra were collected over a m/z range of 3002000. MS/MS

scans were collected using a threshold energy of 35 for collision

induced dissociation. LC-MS/MS data were then searched against

an in-house protein sequence database, containing Swiss-Prot and

the protein constructs speciﬁc to the experiment, using the Mascot

search engine program (Matrix Science, UK) (38).

10 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Database search parameters were set with a precursor tolerance of

5 ppm and a fragment ion mass tolerance of 0.8 Da. Two missed

enzyme cleavages were allowed and variable modiﬁcations for ox-

idized methionine, carbamidomethyl cysteine, pyroglutamic acid,

phosphorylated serine, threonine, tyrosine, tert-butyloxycarbonyl-

lysine, norbornene-lysine and prop-2-yn-1-yloxycarbonyl-lysine

were included. MS/MS data were validated using the Scaffold pro-

gram (Proteome Software Inc., USA) (39). All data were addi-

tionally interrogated manually. For quantitative analysis of repli-

cate runs, NSAF (Normalized Spectral Abundance Factor) values

for each protein hit were used as a proxy of protein abundance ( 40).

NSAF values were used to calculate signiﬁcance and fold-changes

(i.e. consistent enrichment of a given protein in test sample over

control sample).

Bioinformatics

Predicted homology models were generated using Phyre2 (34). For

ortholog searches and sequence alignments PSI-BLAST and align

tools embedded in UniProt, NCBI, ENSEMBL and Tetrahymena

Genome Databases were used. Sequence alignments were visual-

ized using ESPript (41).

Image processing and structure representation tools

FIJI (25) used for all phenotyping and gliding assays. RELION-

3.1 (42) was used for all EM data processing. Cryo-EM

maps were resampled using EMDA (https://www2.mrc-

lmb.cam.ac.uk/groups/murshudov/content/emda/emda.html).

Chimera (33) and ChimeraX (43) used for model ﬁtting and

density map ﬁgure making. Manuscript formatting for Biorxiv

used a modiﬁed LaTeX template from the Henriques Lab

(https://www.overleaf.com/latex/templates/henriqueslab-biorxiv-

template/nyprsybwffws#.Wp8hF1Cnx-E)

Statistical tests and data representation

Usage of one-way ANOVA with Tukey’s test for multiple compar-

isons is indicated wherever applied. High speed videos of cells to

visualize cilia movement were composited using the kapwing online

tool. All graphical representations were generated using GraphPad

Prism 7.

Data and materials availability

Atomic coordinates and cryo-EM maps have been deposited in the

Protein Data Bank under accession code 6ZYW, 6ZYX, 6ZYY and

in the Electron Microscopy Data Bank under accession codes EMD-

11576, EMD-11577, EMD-11578, EMD-11579, EMD-11580,

EMD-11581, EMD-11582, EMD-11583, EMD-11584.

Author contributions

G. R. M. discovered Shulin, performed all cell biological, biochem-

ical and negative stain EM analyses, optimized and prepared ODA-

Shulin cryo-EM samples. C. K. L collected all cryo-EM datasets.

G. R. M., F. A. A. and C. K. L. determined the cryo-EM structure.

A. P. C., C. K. L. and F. A. A. built and reﬁned models. M. S. and F.

B. performed mass spectrometry. A. P. C. and G. R. M. conceived

the project, oversaw its implementation, and with F. A. A. prepared

ﬁgures and wrote the manuscript. All authors contributed to aspects

of manuscript writing and editing.

Conﬂict of interest statement

The authors declare that they have no conﬂicts of interest.

Funding sources

Medical Research Council, UK (MRC_UP_A025_1011) and Well-

come Trust (210711/Z/18/Z) to A.P.C. and (218653/Z/19/Z) to

F.A.A.

ACKNOWLEDGEMENTS

We thank B. Santhanam for help with comparative genomic analyses, J. Grimmett

and T. Darling for data storage and high-performance computing support, MRC

LMB EM Facility (G. Sharov, G. Cannone) and Diamond (eBIC: proposal bi23268)

for microscopy data acquisition support, K. Nguyen and V. Chandrasekaran for mi-

croscopy time, F. Coscia for GO grid assistance, S. Bullock and members of the

Carter lab for comments on the manuscr ipt, C. Stone for ﬁgure scripting and S.

Utekar for suggesting the name Shulin.

Bibliography

1. Iain A. Drummond. Cilia functions in development. Current Opinion in Cell Biology, 24(1):

24–30, 2012. ISSN 09550674. doi: 10.1016/j.ceb.2011.12.007.

2. Ursula W. Goodenough and John E. Heuser. Outer and inner dynein arms of cilia and

ﬂagella. Cell, 41(2):341–342, 1985. ISSN 00928674. doi: 10.1016/s0092-8674(85)80003-9.

3. Margaret W. Leigh, Jessica E. Pittman, Johnny L. Carson, Thomas W. Ferkol, Sharon D.

Dell, Stephanie D. Davis, Michael R. Knowles, and Maimoona A. Zariwala. Clinical and

genetic aspects of primary ciliary dyskinesia/kartagener syndrome. Genetics in Medicine,

11(7):473–487, 2009. ISSN 10983600. doi: 10.1097/GIM.0b013e3181a53562.

4. Stephen M. King. Axonemal dynein arms. Cold Spring Harbor Perspectives in Biology, 8

(11):a028100, 2016. ISSN 19430264. doi: 10.1101/cshperspect.a028100.

5. Mary Elizabeth Fowkes and David Rees Mitchell. The role of preassembled cytoplasmic

complexes in assembly of ﬂagellar dynein subunits. Molecular Biology of the Cell, 1998.

ISSN 10591524. doi: 10.1091/mbc.9.9.2337.

6. Noveera T Ahmed, Chunlei Gao, Ben F Lucker, Douglas G Cole, and David R Mitchell.

ODA16 aids axonemal outer row dynein assembly through an interaction with the intraﬂag-

ellar transport machinery. Journal of Cell Biology, 183:313–322, 2008. ISSN 00219525.

doi: 10.1083/jcb.200802025.

7. Jin Dai, Francesco Barbieri, David R. Mitchell, and Karl F. Lechtreck. In vivo analy-

sis of outer arm dynein transport reveals cargo-speciﬁc intraﬂagellar transport proper-

ties. Molecular Biology of the Cell, 29(21):2553–2565, 2018. ISSN 19394586. doi:

10.1091/mbc.E18-05-0291.

8. J L Rosenbaum, J E Moulder, and D L Ringo. Flagellar elongation and shortening in

Chlamydomonas. The use of cycloheximide and colchicine to study the synthesis and as-

sembly of ﬂagellar proteins. Journal of Cell Biology, 41:600–619, 1969. ISSN 00219525.

doi: 10.1083/jcb.41.2.600.

9. Norman E. Williams, Che Chia Tsao, Josephine Bowen, Gery L. Hehman, Ruth J. Williams,

and Joseph Frankel. The actin gene ACT1 is required for phagocytosis, motility, and

cell separation of Tetrahymena thermophila. Eukaryotic Cell, 5(3):555–567, 2006. ISSN

15359778. doi: 10.1128/EC.5.3.555-567.2006.

10. Christopher R. Wood, Robert Hard, and Todd M. Hennessey. Targeted gene disruption of

dynein heavy chain 7 of Tetrahymena thermophila results in altered ciliary waveform and

reduced swim speed. Journal of Cell Science, 120(17):3075–3085, 2007. ISSN 00219533.

doi: 10.1242/jcs.007369.

11. Gwilym J. Attwell, Connie S. Bricker, Anita Schwandt, Martin A. Gorovsky, and David G.

Pennock. A TemperatureSensitive Mutation Affecting Synthesis of Outer Arm Dyneins

in Tetrahymena thermophila. The Journal of Protozoology, 39(2):261–266, 1992. ISSN

15507408. doi: 10.1111/j.1550-7408.1992.tb01312.x.

12. Ursula Goodenough and John Heuser. Structural comparison of puriﬁed dynein proteins

with in situ dynein arms. Journal of Molecular Biology, 180(4):1083–1118, 1984. ISSN

00222836. doi: 10.1016/0022-2836(84)90272-9.

13. Bill Wickstead and Keith Gull. Dyneins across eukaryotes: A comparative genomic analysis.

Trafﬁc, 8(12):1708–1721, 2007. ISSN 13989219. doi: 10.1111/j.1600-0854.2007.00646.x.

14. Kai Zhang, Helen E. Foster, Arnaud Rondelet, Samuel E. Lacey, Nadia Bahi-Buisson,

Alexander W. Bird, and Andrew P. Carter. Cryo-EM Reveals How Human Cytoplasmic

Dynein Is Auto-inhibited and Activated. Cell, 169(7):1303–1314, 2017. ISSN 10974172.

doi: 10.1016/j.cell.2017.05.025.

15. Katerina Toropova, Ruta Zalyte, Aakash G. Mukhopadhyay, Miroslav Mladenov, Andrew P.

Carter, and Anthony J. Roberts. Structure of the dynein-2 complex and its assembly with in-

traﬂagellar transport trains. Nature Structural and Molecular Biology, 26(9):823–829, 2019.

ISSN 15459985. doi: 10.1038/s41594-019-0286-y.

16. H. Sakakibara, D. R. Mitchell, and R. Kamiya. A Chlamydomonas outer arm dynein mutant

missing the α heavy chain. Journal of Cell Biology, 113(2):615–622, 1991. ISSN 00219525.

doi: 10.1083/jcb.113.3.615.

17. Helgo Schmidt, Ruta Zalyte, Linas Urnavicius, and Andrew P Carter. Structure of human

cytoplasmic dynein-2 primed for its power stroke. Nature, 518(7539):435–438, feb 2015.

ISSN 1476-4687. doi: 10.1038/nature14023.

18. Jianfeng Lin and Daniela Nicastro. Asymmetric distribution and spatial switching of dynein

activity generates ciliary motility. Science, 360(6387):aar1968, 2018. ISSN 10959203. doi:

10.1126/science.aar1968.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 11

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

19. Yang Liu, Keda Zhou, Naifu Zhang, Hui Wei, Yong Zi Tan, Zhening Zhang, Bridget Car-

ragher, Clinton S. Potter, Sheena D’Arcy, and Karolin Luger. FACT caught in the act of

manipulating the nucleosome. Nature, 577(7790):426–431, 2020. ISSN 14764687. doi:

10.1038/s41586-019-1820-0.

20. Andrew M. Sydor, Marco Jost, Katherine S. Ryan, Kaitlyn E. Turo, Colin D. Douglas, Cather-

ine L. Drennan, and Deborah B. Zamble. Metal binding properties of escherichia coli YjiA, a

member of the metal homeostasis-associated COG0523 family of GTPases. Biochemistry,

52(10):1788–1801, 2013. ISSN 00062960. doi: 10.1021/bi301600z.

21. Chanjae Lee, Rachael Cox, Ophelia Papoulas, Amjad Horani, Kevin Drew, Caitlin Devitt,

Steven L Brody, Edward M Marcotte, and John B. Wallingford. Functional partitioning of a

liquid-like organelle during assembly of axonemal dyneins. bioRxiv Cell Biology, 2020. doi:

10.1101/2020.04.21.052837.

22. Sumaya Alkanderi, Elisa Molinari, Ranad Shaheen, Yasmin Elmaghloob, Louise A. Stephen,

Veronica Sammut, Simon A. Ramsbottom, Shalabh Srivastava, George Cairns, Noel Ed-

wards, Sarah J. Rice, Nour Ewida, Amal Alhashem, Kathryn White, Colin G. Miles, David H.

Steel, Fowzan S. Alkuraya, Shehab Ismail, and John A. Sayer. ARL3 Mutations Cause

Joubert Syndrome by Disrupting Ciliary Protein Composition. American Journal of Human

Genetics, 103(4):612–620, 2018. ISSN 15376605. doi: 10.1016/j.ajhg.2018.08.015.

23. Kevin J. Wright, Lisa M. Baye, Anique Olivier-Mason, Saikat Mukhopadhyay, Liyun Sang,

Mandy Kwong, Weiru Wang, Pamela R. Pretorius, Val C. Shefﬁeld, Piali Sengupta, Diane C.

Slusarski, and Peter K. Jackson. An ARL3-UNC119-RP2 GTPase cycle targets myristoy-

lated NPHP3 to the primary cilium. Genes and Development, 25(22):2347–2360, 2011.

ISSN 08909369. doi: 10.1101/gad.173443.111.

24. Douglas L. Chalker. Transformation and Strain Engineering of Tetrahymena. Methods in Cell

Biology, 109:327–345., 2012. ISSN 0091679X. doi: 10.1016/B978-0-12-385967-9.00011-6.

25. Johannes Schindelin, Ignacio Arganda-Carreras, Erwin Frise, Verena Kaynig, Mark Longair,

Tobias Pietzsch, Stephan Preibisch, Curtis Rueden, Stephan Saalfeld, Benjamin Schmid,

Jean Yves Tinevez, Daniel James White, Volker Hartenstein, Kevin Eliceiri, Pavel Toman-

cak, and Albert Cardona. Fiji: An open-source platform for biological-image analysis. Nature

Methods, 9(7):676–682, 2012. ISSN 15487091. doi: 10.1038/nmeth.2019.

26. Erik Meijering, Oleh Dzyubachyk, and Ihor Smal. Methods for cell and particle track-

ing. Methods in Enzymology, 504:183–200, 2012. ISSN 15577988. doi: 10.1016/

B978-0-12-391857-4.00009-4.

27. Ronald D. Vale and Yoko Yano Toyoshima. Rotation and translocation of microtubules in vitro

induced by dyneins from Tetrahymena cilia. Cell, 52(3):459–469, 1988. ISSN 00928674.

doi: 10.1016/S0092-8674(88)80038-2.

28. Sjors H.W. Scheres. RELION: Implementation of a Bayesian approach to cryo-EM structure

determination. Journal of Structural Biology, 180(3):519–530, 2012. ISSN 10478477. doi:

10.1016/j.jsb.2012.09.006.

29. Kai Zhang. Gctf: Real-time CTF determination and correction. Journal of Structural Biology,

193(1):1–12, 2016. ISSN 10958657. doi: 10.1016/j.jsb.2015.11.003.

30. Radosav S. Pantelic, Jannik C. Meyer, Ute Kaiser, Wolfgang Baumeister, and Jürgen M.

Plitzko. Graphene oxide: A substrate for optimizing preparations of frozen-hydrated

samples. Journal of Structural Biology, 170(1):152–156, 2010. ISSN 10478477. doi:

10.1016/j.jsb.2009.12.020.

31. Jasenko Zivanov, Takanori Nakane, and Sjors H.W. Scheres. A Bayesian approach to beam-

induced motion correction in cryo-EM single-particle analysis. IUCrJ, 6(1):5–17, 2019. ISSN

20522525. doi: 10.1107/S205225251801463X.

32. Alexis Rohou and Nikolaus Grigorieff. CTFFIND4: Fast and accurate defocus estimation

from electron micrographs. Journal of Structural Biology, 192(2):216–221, 2015. ISSN

10958657. doi: 10.1016/j.jsb.2015.08.008.

33. Eric F. Pettersen, Thomas D. Goddard, Conrad C. Huang, Gregory S. Couch, Daniel M.

Greenblatt, Elaine C. Meng, and Thomas E. Ferrin. UCSF Chimera - A visualization sys-

tem for exploratory research and analysis. Journal of Computational Chemistry, 25(13):

1605–1612, 2004. ISSN 01928651. doi: 10.1002/jcc.20084.

34. Lawrence A. Kelley, Stefans Mezulis, Christopher M. Yates, Mark N. Wass, and Michael J.E.

Sternberg. The Phyre2 web portal for protein modeling, prediction and analysis. Nature

Protocols, 10(6):845–858, 2015. ISSN 17502799. doi: 10.1038/nprot.2015.053.

35. P. Emsley, B. Lohkamp, W. G. Scott, and K. Cowtan. Features and development of Coot.

Acta Crystallographica Section D: Biological Crystallography, 66(4):486–501, 2010. ISSN

09074449. doi: 10.1107/S0907444910007493.

36. Paul D. Adams, Pavel V. Afonine, Gábor Bunkóczi, Vincent B. Chen, Ian W. Davis, Nathaniel

Echols, Jeffrey J. Headd, Li Wei Hung, Gary J. Kapral, Ralf W. Grosse-Kunstleve, Air-

lie J. McCoy, Nigel W. Moriarty, Robert Oeffner, Randy J. Read, David C. Richardson,

Jane S. Richardson, Thomas C. Terwilliger, and Peter H. Zwart. PHENIX: A compre-

hensive Python-based system for macromolecular structure solution. Acta Crystallograph-

ica Section D: Biological Crystallography, 66(2):213–221, 2010. ISSN 09074449. doi:

10.1107/S0907444909052925.

37. Garib N. Murshudov, Alexei A. Vagin, and Eleanor J. Dodson. Reﬁnement of macro-

molecular structures by the maximum-likelihood method. Acta Crystallographica Sec-

tion D: Biological Crystallography, 53(3):240–255, 1997. ISSN 09074449. doi: 10.1107/

S0907444996012255.

38. David N. Perkins, Darryl J.C. Pappin, David M. Creasy, and John S. Cottrell. Probability-

based protein identiﬁcation by searching sequence databases using mass spectrometry

data. Electrophoresis, 20(18):3551–3567, 1999. ISSN 01730835. doi: 10.1002/(SICI)

1522-2683(19991201)20:18<3551::AID-ELPS3551>3.0.CO;2-2.

39. Andrew Keller, Alexey I. Nesvizhskii, Eugene Kolker, and Ruedi Aebersold. Empirical

statistical model to estimate the accuracy of peptide identiﬁcations made by MS/MS and

database search. Analytical Chemistry, 74(20):5383–5392, 2002. ISSN 00032700. doi:

10.1021/ac025747h.

40. Laurence Florens, Michael J. Carozza, Selene K. Swanson, Marjorie Fournier, Michael K.

Coleman, Jerry L. Workman, and Michael P. Washburn. Analyzing chromatin remodeling

complexes using shotgun proteomics and normalized spectral abundance factors. Methods,

40(4):303–311, 2006. ISSN 10462023. doi: 10.1016/j.ymeth.2006.07.028.

41. Patrice Gouet, Emmanuel Courcelle, David I. Stuart, and Frédéric Métoz. ESPript: Analysis

of multiple sequence alignments in PostScript. Bioinformatics, 15(4):305–308, 1999. ISSN

13674803. doi: 10.1093/bioinformatics/15.4.305.

42. Jasenko Zivanov, Takanori Nakane, and Sjors H.W. Scheres. Estimation of high-order aber-

rations and anisotropic magniﬁcation from cr yo-EM data sets in RELION-3.1. IUCrJ, 7(2):

253–267, 2020. ISSN 20522525. doi: 10.1107/S2052252520000081.

43. Thomas D. Goddard, Conrad C. Huang, Elaine C. Meng, Eric F. Pettersen, Gregory S.

Couch, John H. Morris, and Thomas E. Ferrin. UCSF ChimeraX: Meeting modern chal-

lenges in visualization and analysis. Protein Science, 27(1):14–25, 2018. ISSN 1469896X.

doi: 10.1002/pro.3235.

44. David E. Wilkes, Vidyalakshmi Rajagopalan, Clarence W.C. Chan, Ekaterina Kniazeva,

Alice E. Wiedeman, and David J. Asai. Dynein light chain family in Tetrahymena ther-

mophila. Cell Motility and the Cytoskeleton, 64(2):82–96, 2007. ISSN 08861544. doi:

10.1002/cm.20165.

45. Deborah Penque, Lisete Galego, and Claudina RodriguesPousada. Multiple αtubulin

isoforms in cilia and cytoskeleton of Tetrahymena pyriformis generated by posttransla-

tional modiﬁcations: Studies during reciliation. European Journal of Biochemistry, 195(2):

487–494, 1991. ISSN 14321033. doi: 10.1111/j.1432-1033.1991.tb15729.x.

12 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S1. Puriﬁcation and identiﬁcation of novel interactors of cell body ODAs. (A) SEC trace showing major peak of cell body

ODA complex. Co-eluting proteins were identiﬁed by MS. Molecular weight (MW) in kDa and peptide counts per protein are shown

in the table. (B) SDS-PAGE gel showing IC3-ZZ-FLAG immunoprecipitates from deciliated Tetrahymena cell bodies. Protein bands

were identiﬁed by mass spectrometry. Plot summarizes top hits enriched >3 fold (dotted line) in IC3 (bait protein encircled in red)

over untagged control immunoprecipitates from 4 replicate experiments. Q22MS1 and Q22YU3 are highlighted (blue circles) as novel

interactors.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 13

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S2. Alignment between Q22YU3 and human C20ORF194. Sequence alignment between Tetrahymena Q22YU3

(Q22YU3_TETTS: UNIPROT ID: Q22YU3) and human C20ORF194 (CT194_HUMAN, UNIPROT ID: Q5TEA3) shows 24% identity

highlighting evolutionary conservation. Conserved residues are highlighted in red and similar residues are colored in red with blue

boxes around.

14 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S3. Phenotypic characterization of Q22YU3∆ and Q22MS1∆ mutant strains. (A) Genomic PCRs show amplicons generated

using primers spanning exons 1-3 of Q22YU3 and Q22MS1 in wildtype (WT) and mutant strains. Control PCRs for DYH4 (ODA β-HC)

spanning exon 7 and 3’ untranslated region (UTR) of the gene are shown. (B) Cell images and graph show mutant cells have a

near absence or highly reduced number of food vacuoles (arrowhead) compared to wildtype cells. N=59 cells per genotype. Scale

bar = 10 µm. (C) Immunoﬂuorescence images of wildtype and mutant cells with quantiﬁcation of cytokinesis defects show Q22YU3∆

and Q22MS1∆ cells have a higher frequency of binucleated cells and multiple oral apparatuses compared to wildtype cells. N=25

cells/genotype. Two-way ANOVA was used to calculate p-values; ns=0.07, *p≤0.04, ****p≤0.0001. Scale bar = 10 µm. (D) Cilia

numbers show mutants have similar numbers of cilia to wildtype cells (WT n=31, Q22YU3∆ n=25, Q22MS1∆ n=24). (E) Average cilia

lengths are similar between mutant and wildtype cells (WT n=18 cells, 146 cilia; Q22YU3∆ n=16 cells, 147 cilia; Q22MS1∆ n=22 cells,

238 cilia). (F) A larger ﬁeld of view showing representative cells immunostained for ODA and acetylated α-tubulin (related to Figure

1E). Scale bar = 50 µm. Error bars where used show standard deviation. One-way ANOVA was used unless otherwise indicated to

calculate p-values; ns=not signiﬁcantly different, ****p ≤0.0001.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 15

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S4. ODAs puriﬁed from cell body have a closed conformation. Representative micrograph showing negatively-stained ODA

particles puriﬁed from deciliated Tetrahymena cell bodies. 2D classiﬁcation scheme shows ~270,000 closed ODA (green), open ODA

(pur ple) and ambiguous particles (orange) sorted into respective class averages. Representative 2D class averages corresponding to

40% closed intact ODA particles (green), 60% open intact ODA particles (purple box).

16 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S5. Single particle 2D classiﬁcation scheme. (A) Representative gel ﬁltration traces from reconstitution experiments. (B)

2D classiﬁcation strategy used to sort ODA particles into three conformational states, closed (green), open (purple) and ambiguous (or-

ange). (C-F) SDS-PAGE gel images showing fractions corresponding to traces in (A). Peak fractions were used for negative staining and

particles were counted after several rounds of 2D classiﬁcation. Representative 2D class averages from a ﬁnal round of classiﬁcation

used for ﬁnal subset selection and particle counting are shown. Note: ODA only sample has no closed particles.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 17

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S6. Overview of ODA image processing. A consensus 3D reﬁnement was used as the basis for three main arms of processing

in RELION-3.1: (1) Full-length ODA, Dyh3 and Dyh4 (2) Tail and Shulin region (3) Dyh3 motor.

18 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S7. Validation of map and model quality. (A) Representative micrograph acquired with a K3 camera operated in counting

mode. (B) Selection of some of the ODA-Shulin 2D class averages obtained from the combined datasets. (C) Gold standard Fourier

shell correlation (FSC) curves for the different maps used in this study (FSC=0.143). (D) Angular distribution of particles contributing to

the overall ODA structure. (E-F) Local resolution as determined by RELION-3.1’s local resolution implementation.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 19

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S8. Mass spectrometry guided assignment of ODA subunits. Schematic summarizing mass spectrometry (MS) data for

determination of ODA subunit composition. ODAs puriﬁed from IC3-ZZ-FLAG ciliary immunoprecipitations and isolated from wildtype

cilia, comprise the subunits in bold. Peptide counts from both MS runs are shown in brackets next to protein. These data guided subunit

assignment and accurate model building of the LC-tower region. For assignment, all paralogous LC sequences for Tctex-like, LC8-like

and roadblock-like LC subunits (Tetrahymena Genome Database and reported previously (44)) are shown in purple, blue and green

boxes respectively. LCs with best ﬁts and conﬁrmed via MS are in bold. Exclusive presence of Lc7, Lc7b, Lc8b and Lc10 subunits in

the MS dataset allowed tentative assignment for these chains. Chains in black are not in the structure.

20 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S9. Architecture and organization of the LC tower. (A) The lower and upper regions of the LC tower are stacked against the

Dyh3 chain whereas Lc3 contacts Dyh4 behind the main tower. (B) Focus on DIC N-termini and the interactions they make with the

LCs. LC subunits with an * are tentatively assigned based on mass spectrometry data. The zoom inset highlights the looping of the

Dic2 N-terminus around the upper LC tower. This ﬁgure depicts atomic model of this region with the heavy chains shown as ﬁltered

surface representation (white) and LCs shown as cryo-EM density in (B) and ribbon in (B, inset).

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 21

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S10. ODA motors are locked in an inactive state. (A-B) Shulin stabilizes the closed conformation of ODA indirectly through

several contacts with the tail. Each motor domain has its force-producing linker bent at a 90° angle, indicating an inactive pre-power

stroke conformation. The trajectory of the stalks suggests that they converge at their microtubule binding domains. (C-E) Motor-motor

contacts are shown as spheres. Figure shows ﬁltered surface representation of the atomic model.

22 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S11. Shulin binds GTP and contacts the LC tower. (A) Nucleotide binds at the interface of the Shulin C1 and C2 domains.

Residues in the nucleotide pocket are shown. (B) Shulin’s contacts with Dyh3 tail and motor, holds the linker in a pre-powerstroke

conformation. (C) Contacts between Dyh3 and Dyh4 tail helical bundles, stabilized by Shulin, are shown. (D) Shulin contacts with Lc8e,

Lc8d and Dic2 are shown. Dic2 N-terminal domain (NTD) loop wedged between the two LC subunits is shown. (E) Shulin bridges Dyh3

and LC tower, packing the latter against the Dyh3 tail. Shulin domains making contacts with ODA subunits are in ﬁlled circles.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 23

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Figure S12. Shulin delivers ODAs during de novo ciliogenesis (A) Immunostaining of cells regenerating motile cilia after deciliation

shows Shulin enters actively extending cilia marked by acetylated α-tubulin. Insets highlight ciliary staining for Shulin. (B) Immunos-

taining of cells with fully assembled cilia shows Shulin localizes to the cytoplasm. Insets highlight residual ciliary staining for Shulin.

(C-D) SHULIN∆ cells stained as above, lacking Shulin signal serve as immunostaining controls. Note: differences in tubulin staining

between regenerating cilia and fully assembled cilia reﬂect differences in tubulin acetylation which occurs after microtubule assembly

in Tetrahymena axonemes (45).

24 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

UNIPROT ID

PROTEIN ID

MW (kDa)

P-value

I7MHB1_TETTS

Lc7

0.53

4.85

I7M9J2_TETTS

Dyh4/ODA β-HC

530

1.82

4.57

Q22A67_TETTS

Dyh3/ODA γ-HC

534

2.23

4.51

Q22MS1_TETTS

NDK-domain Protein

222

0.58

4.26

Q22YU3_TETTS

Shulin

140

1.03

4.12

I7LX00_TETTS

Haemoglobin-like Protein

0.70

4.03

I7M1N7_TETTS

Lc1

1.55

4.03

A4VD75_TETTS

Lc3

0.62

4.01

Q231E4_TETTS

Ttp95-like Protein

126

1.67

3.88

I7M008_TETTS

Dic2/ ODA IC

1.27

3.87

Q1HGH8_TETTH

Lc2a

0.46

3.63

I7M6H4_TETTS

Dyh5/ODA

⍺

-HC

475

2.98

3.54

Q23FU1_TETTS

Dic3/ ODA IC (Bait)

4.55

3.52

W7X3J8_TETTS

Na/Ca Exchanger Protein

1.06

3.51

Q1HFX4_TETTH

Lc4a

0.46

3.42

Q23QY3_TETTS

Uba1

117

0.46

3.40

Q22AU5_TETTS

SLEI-family Protein

283

0.44

3.34

I7M9Z0_TETTS

Copg2

283

0.46

3.33

W7XJB1_TETTS

Lc8

0.46

3.32

I7MFH3_TETTS

Cytochrome C-like Protein

0.46

3.31

Q23AC8_TETTS

Dnajb6

0.60

3.28

Q24FD6_TETTS

Dnaja2

1.32

3.24

W7XEU3_TETTS

Cystatin-domain Protein

0.46

3.14

Table S1. Quantitative mass spectrometry hits of novel ODA cell body interactors. Label-free quantitative MS list of high abun-

dance proteins speciﬁcally co-precipitating with IC3-ZZ-FLAG from quadruplicate runs. Shulin and Q22MS1 are highlighted. Proteins

in bold letters are part of the preassembled ODA complex in the cell body. MW = molecular weight, FC = log

fold-change, P-value

signiﬁcance is in -log

scale.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 25

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

ODA-S_1

ODA-S_2

Data collection and processing

Microscope

TFS Titan Krios

(LMB)

TFS Titan Krios (eBIC)

Detector

Magnification (nominal)

81,000x

Pixel size (Å)

1.11

0.53 (super- res)

Energy filter slit width (eV)

Voltage (kV)

300

Number of frames

Exposure (s)

2.6

Voltage (kV)

300

Electron exposure on sample (e–/Å

)

Target defocus range (µm)

1.2-3

1.5-3

Number of sessions

Number of collected movies

40,158

10,463

Particle numbers after removing graphene oxide

artifacts/ice contamination

1,300,000

Final particle numbers and map resolution at

FSC=0.143 (Å)

Full-length: 131,142; 8.8 (EMD-11576)

Tail:

131,142; 6.7 (EMD-11577)

Ordered tail: 56,667; 5.9 (EMD-11578)

Shulin region: 43,338; 4.3 (EMD-11579)

Extended Shulin region: 43,338; 4.6 (EMD-11580)

Dyh3 motor region: 49,397; 4.4 (EMD-11581)

Dyh4 motor: 57,761; 5.0 (EMD-11582)

Dyh5 motor: 49,756; 5.6 (EMD-11583)

Extended Dyh5 motor: 49,756;

9.3 (EMD-11584)

Table S2. Cryo-EM data collection and processing

26 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Shulin

region

Dyh3 region

Dyh4

Dyh5

Ordered tail

NDD tail*

Map

EMD-11579

EMD-11581

EMD-11582

EMD-11583

EMD-11577

Map resolution (Å)

FSC threshold

4.3

0.143

4.4

0.143

5.0

0.143

5.6

0.143

5.9

0.143

6.7

0.143

Map sharpening B

factor (Å

)

-200

-131

-148

-100

n/a

Map CC (around

atoms)

0.74

0.72

0.68

0.63

0.61

0.19*

Model composition

Non-hydrogen

atoms

Protein residues

Ligands

(ATP/ADP/GTP)

16,594

2,041

0/ 0/ 1

22,561

2,988

1/ 3/ 0

14,072

2,842

0/ 0/ 0

14,264

2,880

0/ 0/ 0

27,251

5,501

0/ 0/ 1

4,879

983

0/ 0/ 0

R.M.S. deviations

Bond lengths (Å)

Bond angles (°)

0.007

1.275

0.008

1.380

0.016

1.630

0.006

1.506

0.013

1.943

0.011

2.064

Validation

MolProbity score

Clashscore

Poor rotamers (%)

1.97

6.57

0.06

2.05

7.63

0.00

1.90

4.96

0.00

1.83

4.32

0.00

1.70

2.99

0.00

1.60

2.58

0.00

Ramachandran plot

Favored (%)

Disallowed (%)

Cβ deviations (%)

87.82

0.00

0.05

86.33

0.20

0.18

86.22

0.58

0.07

87.12

0.25

0.11

87.29

0.35

0.30

89.76

0.41

0.32

Table S3. Reﬁnement and validation statistics. * The ﬂexible NDD region of the tail was modeled into low resolution density at low

threshold.

Mali et al. | Shulin locks ODAs for delivery to the cilia bioRχiv | 27

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint

Movie. S1. Movie shows slow moving cilia (arrows) in Q22YU3 and Q22MS1 mutant cells compared to the wildtype cells

which have fast-moving cilia (arrows).

Movie. S2. Movie shows slow moving cilia (arrows) in the temperature sensitive OAD1 C11 mutant cell, which has reduced

ODAs in cilia compared to the wildtype cell which has normal ciliary ODA levels and fast-moving cilia (arrows).

Movie. S3. Movie depicting the model of ODA bound by Shulin (green). Subunits are listed and contacts made by Shulin with

the various ODA subunits are shown as green spheres.

28 | bioRχiv Mali et al. | Shulin locks ODAs for delivery to the cilia

The copyright holder for this preprintthis version posted September 4, 2020. ; https://doi.org/10.1101/2020.09.04.282897doi: bioRxiv preprint